콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU112661

Sigma-Aldrich

MISSION® esiRNA

targeting human BNIP3

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

CTGGACGGAGTAGCTCCAAGAGCTCTCACTGTGACAGCCCACCTCGCTCGCAGACACCACAAGATACCAACAGAGCTTCTGAAACAGATACCCATAGCATTGGAGAGAAAAACAGCTCACAGTCTGAGGAAGATGATATTGAAAGAAGGAAAGAAGTTGAAAGCATCTTGAAGAAAAACTCAGATTGGATATGGGATTGGTCAAGTCGGCCGGAAAATATTCCCCCCAAGGAGTTCCTCTTTAAACACCCGAAGCGCACGGCCACCCTCAGCATGAGGAACACGAGCGTCATGAAGAAAGGGGGCATATTCTCTGCAGAATTTCTGAAAGTTTTCCTTCCATCTCTGCTGCT

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

관련 카테고리

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Xianjie Li et al.
International journal of molecular medicine, 46(2), 729-739 (2020-07-07)
Long non‑coding RNA (lncRNA) DGCR5 has been identified as a tumor suppressor in several types of cancer. However, its biological functions in pancreatic cancer (PaCa) have not yet been fully elucidated. The present study was designed to investigate the role
Zhiliang He et al.
Acta biochimica et biophysica Sinica, 49(1), 25-32 (2016-11-20)
Nutrition deficiency is reported to induce apoptosis of chondrocytes and degeneration of cartilage endplate (CEP) in rabbit. Cartilage endplate stem cells (CESCs) are important for the integrity of structure and function of CEP. Bcl-2/adenovirus E1B 19-kDa-interacting protein 3 (BNIP3) has
Zong-Jie Fu et al.
Redox biology, 36, 101671-101671 (2020-08-24)
In the present study, we hypothesized that hypoxia-inducible factor 1α (HIF-1α)-mediated mitophagy plays a protective role in ischemia/reperfusion (I/R)-induced acute kidney injury (AKI). Mitophagy was evaluated by measuring the changes of mitophagy flux, mitochondria DNA copy number, and the changes
Chongcheng Wang et al.
Cell death & disease, 11(8), 630-630 (2020-08-18)
Induction of lethal autophagy has become a strategy to eliminate glioma cells, but it remains elusive whether autophagy contributes to cell death via causing mitochondria damage and nuclear translocation of apoptosis inducing factor (AIF). In this study, we find that
Jie Liu et al.
Molecular medicine reports, 16(5), 7253-7260 (2017-09-26)
Nutrient deprivation (ND)‑induced nucleus pulposus (NP) cell death serves an important role in intervertebral disc degeneration disease. However, the underlying mechanisms have yet to be thoroughly elucidated. The present study created a cell culture model under ND conditions to investigate

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.