콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU111851

Sigma-Aldrich

MISSION® esiRNA

targeting human USP8

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

AAATTTGTTGGGGCATAAAGGTGAAGTGGCAGAAGAATTTGGTATAATCATGAAAGCCCTGTGGACAGGACAGTATAGATATATCAGTCCAAAGGACTTTAAAATCACCATTGGGAAGATCAATGACCAGTTTGCAGGATACAGTCAGCAAGATTCACAAGAATTGCTTCTGTTCCTAATGGATGGTCTCCATGAAGATCTAAATAAAGCTGATAATCGGAAGAGATATAAAGAAGAAAATAATGATCATCTCGATGACTTTAAAGCTGCAGAACATGCCTGGCAGAAACACAAGCAGCTCAATGAGTCTATTATTGTTGCACTTTTTCAGGGTCAATTCAAATCTACAGTACAGTGCCTCACATGTCACAAAAAGTCTAGGACATTTGAGGCCTTCATG

Ensembl | 인체 수납 번호

ENSG00000138592

NCBI 수납 번호

NM_005154

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... USP8(9101) , USP8(9101)

관련 카테고리

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number
OWU
QCS
PNS

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

COA 검색

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Jinghui Zhang et al.
Biochimica et biophysica acta. General subjects, 1864(12), 129701-129701 (2020-08-21)
Background Organic anion transporter 1 (OAT1) plays a vital role in avoiding the potential toxicity of various anionic drugs through the involvement of kidney elimination. We previously demonstrated that ubiquitin conjugation to OAT1 led to OAT1 internalization from cell surface
Tania Martins-Marques et al.
Life science alliance, 3(12) (2020-10-25)
Ischemic heart disease has been associated with an impairment on intercellular communication mediated by both gap junctions and extracellular vesicles. We have previously shown that connexin 43 (Cx43), the main ventricular gap junction protein, assembles into channels at the extracellular
Soyeon Shin et al.
Cell death and differentiation, 27(4), 1341-1354 (2019-09-19)
Notch, an essential factor in tissue development and homoeostasis, has been reported to play an oncogenic function in a variety of cancers. Here, we report ubiquitin-specific protease 8 (USP8) as a novel deubiquitylase of Notch1 intracellular domain (NICD). USP8 specifically
Hong Peng et al.
Autophagy, 16(4), 698-708 (2019-06-27)
SQSTM1/p62 (sequestosome 1) is a critical macroautophagy/autophagy receptor that promotes the formation and degradation of ubiquitinated aggregates. SQSTM1 can be modified by ubiquitination, and this modification modulates its autophagic activity. However, the molecular mechanisms underpinning its reversible deubiquitination have never

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.