콘텐츠로 건너뛰기
Merck
모든 사진(1)

문서

EHU111751

Sigma-Aldrich

MISSION® esiRNA

targeting human PRDX1

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

TTGAACCCCAAGCTGATAGGAAGATGTCTTCAGGAAATGCTAAAATTGGGCACCCTGCCCCCAACTTCAAAGCCACAGCTGTTATGCCAGATGGTCAGTTTAAAGATATCAGCCTGTCTGACTACAAAGGAAAATATGTTGTGTTCTTCTTTTACCCTCTTGACTTCACCTTTGTGTGCCCCACGGAGATCATTGCTTTCAGTGATAGGGCAGAAGAATTTAAGAAACTCAACTGCCAAGTGATTGGTGCTTCTGTGGATTCTCACTTCTGTCATCTAGCATGGGTCAATACACCTAAGAAACAAGGAGGACTGGGACCCATGAACATTCCTTTGGTATCAGACCCGAAGCGCACCATTGCTCAGGATTATGGGGTCTTAAAGGCTGATGAAGGCATCTCGTTCAGGGGCCTTTTTATCATTGATGATAAGGGTATTCTTCGGCAGATCA

Ensembl | 인체 수납 번호

ENSG00000117450

NCBI 수납 번호

NM_002574

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... PRDX1(5052) , PRDX1(5052)

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

N Cong et al.
European review for medical and pharmacological sciences, 22(7), 1922-1928 (2018-04-25)
Peroxiredoxin1 (PRDX1), a class of thiol peroxidases, is a multifunctional protein. We aimed at analyzing the effect of PRDX1 on proliferation, apoptosis, migration and invasion of colorectal cancer and to investigate the potential mechanism. Western blot and PCR were used
Jean-Louis Guéant et al.
Nature communications, 9(1), 67-67 (2018-01-06)
To date, epimutations reported in man have been somatic and erased in germlines. Here, we identify a cause of the autosomal recessive cblC class of inborn errors of vitamin B
Qing Ye et al.
Cell chemical biology, 26(3), 366-377 (2019-01-22)
Peroxiredoxin 1 (Prx1) and glutaredoxin 3 (Grx3) are two major antioxidant proteins that play a critical role in maintaining redox homeostasis for tumor progression. Here, we identify the prototypical pyranonaphthoquinone natural product frenolicin B (FB) as a selective inhibitor of
Min Zhang et al.
Oncology letters, 10(3), 1841-1847 (2015-12-02)
Peroxiredoxin 1 (Prx1) has a significant role in several malignant types of tumor. However, the role of Prx1 in oral leukoplakia (OLK) has remained to be elucidated. OLK is a common precancerous lesion of the oral mucosa that has a
Jung Mi Lim et al.
The Journal of cell biology, 210(1), 23-33 (2015-07-08)
Proteins associated with the centrosome play key roles in mitotic progression in mammalian cells. The activity of Cdk1-opposing phosphatases at the centrosome must be inhibited during early mitosis to prevent premature dephosphorylation of Cdh1-an activator of the ubiquitin ligase anaphase-promoting

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.