콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU110021

Sigma-Aldrich

MISSION® esiRNA

targeting human SLC25A5

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

AGCTGGAGCTGAAAGGGAATTCCGAGGCCTCGGTGACTGCCTGGTTAAGATCTACAAATCTGATGGGATTAAGGGCCTGTACCAAGGCTTTAACGTGTCTGTGCAGGGTATTATCATCTACCGAGCCGCCTACTTCGGTATCTATGACACTGCAAAGGGAATGCTTCCGGATCCCAAGAACACTCACATCGTCATCAGCTGGATGATCGCACAGACTGTCACTGCTGTTGCCGGGTTGACTTCCTATCCATTTGACACTGTTCGCCGCCGCATGATGATGCAGTCAGGGCGCAAAGGAACTGACATCATGTACACAGGCACGCTTGACTGCTGGCGGAAGATTGCTCGTGATGAAGGAGGCAAAGCTTTTTTCAAGGGTGCATGGTCCAATGTTCTCAGAGGCATGGG

Ensembl | 인체 수납 번호

ENSG00000005022

NCBI 수납 번호

NM_001152

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... SLC25A5(292) , SLC25A5(292)

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Yun Choi et al.
BMC cancer, 13, 143-143 (2013-03-26)
It is important to simultaneously induce strong cell death and antitumor immunity in cancer patients for successful cancer treatment. Here, we investigated the cytotoxic and phenotypic modulation effects of the combination of ANT2 shRNA and human sodium iodide symporter (hNIS)
Linh Ho et al.
Aging, 5(11), 835-849 (2013-12-04)
Efficient coupling of cellular energy production to metabolic demand is crucial to maintain organismal homeostasis. Here, we report that the mitochondrial Sirtuin Sirt4 regulates mitochondrial ATP homeostasis. We find that Sirt4 affects mitochondrial uncoupling via the adenine nucleotide translocator 2
Ji-Young Jang et al.
Breast cancer research : BCR, 10(1), R11-R11 (2008-02-13)
Adenine nucleotide translocator (ANT) 2 is highly expressed in proliferative cells, and ANT2 induction in cancer cells is known to be directly associated with glycolytic metabolisms and carcinogenesis. In addition, ANT2 repression results in the growth arrest of human cells
Ji-Young Jang et al.
Molecular cancer, 9, 262-262 (2010-09-30)
Tumor necrosis factor (TNF)-related apoptosis-inducing ligand (TRAIL; apo2 ligand) induces apoptosis in cancer cells but has little effect on normal cells. However, many cancer cell types are resistant to TRAIL-induced apoptosis, limiting the clinical utility of TRAIL as an anti-cancer
Ji-Young Jang et al.
Experimental & molecular medicine, 45, e3-e3 (2013-01-12)
MicroRNAs (miRNAs) participate in diverse biological functions and carcinogenesis by inhibiting specific gene expression. We previously reported that suppression of adenine nucleotide translocase 2 (ANT2) by using the short hairpin RNA (shRNA) approach has an antitumor effect in several cancer
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.