설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
형태
lyophilized powder
esiRNA cDNA 표적 서열
CCTCTCACGGAGGCATCTTATGTTAACCTACCTACCATTGCGCTGTGTAACACAGATTCTCCTCTGCGCTATGTGGACATTGCCATCCCATGCAACAACAAGGGAGCTCACTCAGTGGGTTTGATGTGGTGGATGCTGGCTCGGGAAGTTCTGCGCATGCGTGGCACCATTTCCCGTGAACACCCATGGGAGGTCATGCCTGATCTGTACTTCTACAGAGATCCTGAAGAGATTGAAAAAGAAGAGCAGGCTGCTGCTGAGAAGGCAGTGACCAAGGAGGAATTTCAGGGTGAATGGACTGCTCCCGCTCCTGAGTTCACTGCTACTCAGCCTGAGGTTGCAGACTGGTCTGAAGGTGTACAGGTGCCCTCTGTGCCTATTCAGCAATTCCCTACTGAAGACTGGAGCG
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... RPSA(3921) , RPSA(3921)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
시험 성적서(COA)
제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.
Thandokuhle Khumalo et al.
PloS one, 10(10), e0139584-e0139584 (2015-10-02)
Cancer is a global burden due to high incidence and mortality rates and is ranked the second most diagnosed disease amongst non-communicable diseases in South Africa. A high expression level of the 37kDa/67kDa laminin receptor (LRP/LR) is one characteristic of
Kiashanee Moodley et al.
PloS one, 8(3), e57409-e57409 (2013-03-09)
The non-integrin laminin receptor, here designated the 37-kDa/67-kDa laminin receptor (LRP/LR), is involved in many physiologically relevant processes, as well as numerous pathological conditions. The overexpression of LRP/LR on various cancerous cell lines plays critical roles in tumour metastasis and
Guanhong Luo et al.
Oncotarget, 8(42), 71630-71641 (2017-10-27)
Cellular prion protein (PrPC), the infective agent of transmissible spongiform encephalopathies, is thought to be related to several cellular physiological and physiopathological processes. We have previously reported that PrPC participates in multi-drug-resistance of gastric cancer. As the salient ligand molecule
Carryn J Chetty et al.
Experimental cell research, 360(2), 264-272 (2017-09-14)
The 37kDa/67kDa laminin receptor (LRP/LR) serves various physiological and pathological roles such as enhancing tumour-related processes including metastasis, angiogenesis, cellular viability and telomerase activation in cancerous cell lines. The present study investigates the effect of siRNA mediated downregulation of LRP/LR
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.