콘텐츠로 건너뛰기
Merck
모든 사진(1)

Key Documents

EHU109721

Sigma-Aldrich

MISSION® esiRNA

targeting human UBA2

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

TGGTAGCACCAGATGTCCAAATTGAAGATGGGAAAGGAACAATCCTAATATCTTCCGAAGAGGGAGAGACGGAAGCTAATAATCACAAGAAGTTGTCAGAATTTGGAATTAGAAATGGCAGCCGGCTTCAAGCAGATGACTTCCTCCAGGACTATACTTTATTGATCAACATCCTTCATAGTGAAGACCTAGGAAAGGACGTTGAATTTGAAGTTGTTGGTGATGCCCCGGAAAAAGTGGGGCCCAAACAAGCTGAAGATGCTGCCAAAAGCATAACCAATGGCAGTGATGATGGAGCTCAGCCCTCCACCTCCACAGCTCAAGAGCAAGATGACGTTCTCATAGTTGATTCAGATGAAGAAGATTCTTCAAATAATGCCGACGTCAGTGAAGAAGAGAGAAGCCGCAA

Ensembl | 인체 수납 번호

ENSG00000126261

NCBI 수납 번호

NM_005499

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... UBA2(10054) , UBA2(10054)

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Biying Jiang et al.
Journal of cellular biochemistry, 120(8), 12752-12761 (2019-03-09)
Ubiquitin activating enzyme 2 (UBA2) is a basic component of E1-activating enzyme in the SUMOylation system. Expression and function of UBA2 in human cancers are largely unknown. In this study we investigate UBA2 expression the function in human non-small-cell lung
Xingyue He et al.
PloS one, 10(4), e0123882-e0123882 (2015-04-11)
SUMOylation is a post-translational ubiquitin-like protein modification pathway that regulates important cellular processes including chromosome structure, kinetochore function, chromosome segregation, nuclear and sub-nuclear organization, transcription and DNA damage repair. There is increasing evidence that the SUMO pathway is dysregulated in
Xiaoke Liu et al.
Journal of hematology & oncology, 8, 67-67 (2015-06-13)
SUMO-activating enzyme subunit 2 (SAE2) is the sole E1-activating enzyme required for numerous important protein SUMOylation, abnormal of which is associated with carcinogenesis. SAE2 inactivation was recently reported to be a therapeutic strategy in cancers with Myc overexpression. However, the

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.