설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
TCTATCAGTCGGTGCCATCATCGGCAAGCAGGGCCAGCACATCAAGCAGCTTTCTCGCTTTGCTGGAGCTTCAATTAAGATTGCTCCAGCGGAAGCACCAGATGCTAAAGTGAGGATGGTGATTATCACTGGACCACCAGAGGCTCAGTTCAAGGCTCAGGGAAGAATTTATGGAAAAATTAAAGAAGAAAACTTTGTTAGTCCTAAAGAAGAGGTGAAACTTGAAGCTCATATCAGAGTGCCATCCTTTGCTGCTGGCAGAGTTATTGGAAAAGGAGGCAAAACGGTGAATGAACTTCAGAATTTGTCAAGTGCAGAAGTTGTTGTCCCTCGTGACCAGACACCTGATGAGAATGACCAAGTGGTTGTCAAAATAACTGGTCACTTCTATGCTTGCCAGGTTGCCCAGAGAAAAATTCAGGAAATTCTGACTCAGGTAAAGCAGCACCAACAACAGAAGGCTCTGCAAAGTGGAC
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... IGF2BP3(10643) , IGF2BP3(10643)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Huidi Liu et al.
Frontiers in oncology, 9, 1570-1570 (2020-02-23)
Ovarian Clear Cell Carcinoma (OCCC) displays distinctive clinical and molecular characteristics and confers the worst prognosis among all ovarian carcinoma histotypes when diagnosed at advanced stage, because of the lack of effective therapy. IGF2BP3 is an RNA binding protein that
Yonglei Liu et al.
Journal of cellular and molecular medicine, 21(9), 1979-1988 (2017-05-20)
CD44, a cell adhesion protein, involves in various process in cancer such as cell survival and metastasis. Most researches on CD44 in cancer focus on cancer cells. Recently, it is found that CD44 expression is high in fibroblasts of tumour
Douglas Hanniford et al.
Cancer cell, 37(1), 55-70 (2020-01-15)
Metastasis is the primary cause of death of cancer patients. Dissecting mechanisms governing metastatic spread may uncover important tumor biology and/or yield promising therapeutic insights. Here, we investigated the role of circular RNAs (circRNA) in metastasis, using melanoma as a
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.