콘텐츠로 건너뛰기
Merck
모든 사진(1)

문서

EHU107781

Sigma-Aldrich

MISSION® esiRNA

targeting human FFAR3

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

CTACAACGTGTCCCATGTCGTGGGCTATATCTGCGGTGAAAGCCCGGCGTGGAGGATCTACGTGACGCTTCTCAGCACCCTGAACTCCTGTGTCGACCCCTTTGTCTACTACTTCTCCTCCTCCGGGTTCCAAGCCGACTTTCATGAGCTGCTGAGGAGGTTGTGTGGGCTCTGGGGCCAGTGGCAGCAGGAGAGCAGCATGGAGCTGAAGGAGCAGAAGGGAGGGGAGGAGCAGAGAGCGGACCGACCAGCTGAAAGAAAGACCAGTGAACACTCACAGGGCTGTGGAACTGGTGGCCAGGTGGCCTGTGCTGAAAGCTAGGTCCTCCGGGGGAGGAGGGTGTAGCTGGCATGTCATCCTCAGGGCGCTTCCTCGCTCACGCCAGGAGGGACTTGGAGTGGCGAGCTGGGGCCCGATGGGGCTTGGGGGCAGAGTAGACATCTAGCCTCCCTAAGGGTATGCGCGCTAAAGCCCAGCTCTCGATCTCACCTCC

Ensembl | 인체 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Hideo Ohira et al.
Lipids in health and disease, 15(1), 213-213 (2016-12-13)
Interactions between adipocytes and macrophages are associated with metabolic disorders. Production of pro-inflammatory mediators and the release of free fatty acids (FFAs) increase when these cells are co-cultured; butyrate significantly diminishes these effects by suppressing both the macrophage inflammatory and
Hope Eveline Carter Moylan et al.
Molecular human reproduction, 26(6), 452-468 (2020-04-03)
Spontaneous preterm birth is a global health issue affecting up to 20% of pregnancies and leaves a legacy of neurodevelopmental complications. Inflammation has been implicated in a significant proportion of preterm births, where pro-inflammatory insults trigger production of additional pro-inflammatory
Rebecca Roy et al.
Journal of molecular endocrinology, 65(2), 21-34 (2020-06-25)
Gestational diabetes mellitus (GDM) affects up to 16% of pregnant women and is associated with significant long-term health detriments for the mother and her offspring. Two central features of GDM are low-grade inflammation and maternal peripheral insulin resistance, therefore therapeutics
Estela Lorza-Gil et al.
Scientific reports, 10(1), 16497-16497 (2020-10-07)
The expression of short chain fatty acid receptors FFA2 and FFA3 in pancreatic islets raised interest in using them as drug targets for treating hyperglycemia in humans. This study aims to examine the efficacy of synthetic FFA2- and FFA3-ligands to
Mamiko Kobayashi et al.
Biochemical and biophysical research communications, 486(2), 499-505 (2017-03-23)
Short-chain fatty acids (SCFAs), such as acetate, propionate, and butyrate, are produced predominantly by gut microbiota fermentation of dietary fiber. SCFAs are newly identified as endogenous ligands of two orphan G protein-coupled receptors, GPR41 and GPR43, which have the potential

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.