설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
CCCAGTAGCCAAGATGGTGTGTGGGCCCTCAGGCTCCCAGCTTGTCCTGCTCAAGCTGGAGAGATCTGTGACCCTGAACCAGCGTGTGGCCCTGATCTGCCTGCCCCCTGAATGGTATGTGGTGCCTCCAGGGACCAAGTGTGAGATTGCAGGCTGGGGTGAGACCAAAGGTACGGGTAATGACACAGTCCTAAATGTGGCCTTGCTGAATGTCATCTCCAACCAGGAGTGTAACATCAAGCACCGAGGACGTGTGCGGGAGAGTGAGATGTGCACTGAGGGACTGTTGGCCCCTGTGGGGGCCTGTGAGGGTGACTACGGGGGCCCACTTGCCTGCTTTACCCACAACTGCTGGGTCCTGGAAGGAATTATAATCCCCAACCGAGTATGCGCAAGGTCCCGCTGGCCAGCTGTCTTCACGCGTGTCTCTGTGT
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... MST1(4485) , MST1(4485)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Liver × receptor ligands disrupt breast cancer cell proliferation through an E2F-mediated mechanism.
Trang Nguyen-Vu et al.
Breast cancer research : BCR, 15(3), R51-R51 (2013-07-03)
Liver × receptors (LXRs) are members of the nuclear receptor family of ligand-dependent transcription factors and have established functions as regulators of cholesterol, glucose, and fatty acid metabolism and inflammatory responses. Published reports of anti-proliferative effects of synthetic LXR ligands
E2F2 induction in related to cell proliferation and poor prognosis in non-small cell lung carcinoma.
Li Chen et al.
International journal of clinical and experimental pathology, 8(9), 10545-10554 (2015-12-01)
E2F transcription factors regulate a wide range of biological processes, including cell cycle, apoptosis and DNA damage response. In the present study, we examined whether E2F2 is related to the poor prognosis of NSCLC and its role in progress of
Zheng-Qing Fang et al.
Journal of cellular biochemistry, 119(10), 8317-8324 (2018-06-23)
We intended to evaluate miR-490-5p expression in hepatocellular carcinoma (HCC) tissues and detect the potential targets of miR-490-5p. In vitro experiments were conducted to further investigate the biological function of miR-490-5p on HCC cell metastasis. We investigated the abnormally expressed
Shiguan Wang et al.
Arthritis research & therapy, 20(1), 225-225 (2018-10-06)
Expression of E2F transcription factor 2 (E2F2), a transcription factor related to the cell cycle, is abnormally high in rheumatoid arthritis synovial fibroblasts (RASFs). Deregulated expression of E2F2 leads to abnormal production of proinflammatory cytokines, such as interleukin (IL)-1α, IL-1β
Hang Song et al.
Journal of physiology and biochemistry, 72(4), 733-744 (2016-08-16)
Glioblastoma multiforme (GBM), the most common and lethal primary brain tumor in adults characterized by high proliferative ability and mortality rate, contains a small subpopulation of cancer stem-like cells (CSCs), which is responsible for GBM progression and therapeutic resistance. Numerous
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.