설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
AGCCCAGATGAACCAATGACAAATTTGGAATTAAAAATATCTGCCTCCCTAAAACAAGCACTTGATAAACTTAAACTGTCATCAGGGAATGAAGAAAATAAGAAAGAAGAAGACAATGATGAAATTAAGATTGGGACCTCATGTAAGAATGGAGGGTGTTCAAAGACATACCAGGGTCTAGAGAGTCTAGAAGAAGTCTGTGTATATCATTCTGGAGTACCTATTTTCCATGAGGGGATGAAATACTGGAGCTGTTGTAGAAGAAAAACTTCTGATTTTAATACATTCTTAGCCCAAGAGGGCTGTACAAAAGGGAAACACATGTGGACTAAAAAAGATGCTGGGAAAAAAGTTGTTCCATGTAGACATGACTGGCATCAGACTGGAGGTGAAGTTACCATTTCAGTATATGCTAAAAACTCACTTCCAGAACTTAGCCGAG
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... CHORDC1(26973) , CHORDC1(26973)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Federica Fusella et al.
Nature communications, 8(1), 1636-1636 (2017-11-22)
NF-κB is a transcription factor involved in the regulation of multiple physiological and pathological cellular processes, including inflammation, cell survival, proliferation, and cancer cell metastasis. NF-κB is frequently hyperactivated in several cancers, including triple-negative breast cancer. Here we show that
Fumihiko Urabe et al.
Science advances, 6(18), eaay3051-eaay3051 (2020-06-05)
Extracellular vesicles (EVs) are involved in intercellular communication during cancer progression; thus, elucidating the mechanism of EV secretion in cancer cells will contribute to the development of an EV-targeted cancer treatment. However, the biogenesis of EVs in cancer cells is
Federica Fusella et al.
The Journal of pathology, 234(2), 152-163 (2014-03-13)
Morgana/CHP-1 is a ubiquitously expressed protein able to inhibit ROCK II kinase activity. We have previously demonstrated that morgana haploinsufficiency leads to multiple centrosomes, genomic instability, and higher susceptibility to tumour development. While a large fraction of human cancers has
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.