설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
GATTTGGCACCTATGCACCTCCAGAGGTTCCGAGAAGTAAAGCTTTGGAGGTCACAAAATTAGCAATAGAAGCTGGGTTCCGCCATATAGATTCTGCTCATTTATACAATAATGAGGAGCAGGTTGGACTGGCCATCCGAAGCAAGATTGCAGATGGCAGTGTGAAGAGAGAAGACATATTCTACACTTCAAAGCTTTGGTCCACTTTTCATCGACCAGAGTTGGTCCGACCAGCCTTGGAAAACTCACTGAAGAAAGCTCAATTGGACTATGTTGACCTCTATCTTATTCATTCTCCAATGTCTCTAAAGCCAGGTGAGGAACTTTCACCAACAGATGAAAATGGAAAAGTAATATTTGACATAGTGGATCTCTGTACCACCTGGGAGGCCATGGAGAAGTGTAAGGATGCAGGATTGGCCAAGTCCATTGGGGTGTCAAA
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... AKR1C3(8644) , AKR1C3(8644)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Yoshitaka Sekine et al.
Oncology letters, 15(3), 3167-3172 (2018-02-13)
Statins have become of interest in research due to their anticancer effects. However, the exact mechanism of their anticancer properties remains unclear. The authors previously reported that statins decrease intracellular cholesterol levels in androgen-independent prostate cancer cells. In de novo
Melanie M Erzinger et al.
PloS one, 11(3), e0150219-e0150219 (2016-03-08)
The chemoprotective properties of sulforaphane (SF), derived from cruciferous vegetables, are widely acknowledged to arise from its potent induction of xenobiotic-metabolizing and antioxidant enzymes. However, much less is known about the impact of SF on the efficacy of cancer therapy
Chengfei Liu et al.
Molecular cancer therapeutics, 18(10), 1875-1886 (2019-07-17)
The mechanisms resulting in resistance to next-generation antiandrogens in castration-resistant prostate cancer are incompletely understood. Numerous studies have determined that constitutively active androgen receptor (AR) signaling or full-length AR bypass mechanisms may contribute to the resistance. Previous studies established that
Chengfei Liu et al.
Molecular cancer therapeutics, 16(1), 35-44 (2016-10-30)
Abiraterone suppresses intracrine androgen synthesis via inhibition of CYP17A1. However, clinical evidence suggests that androgen synthesis is not fully inhibited by abiraterone and the sustained androgen production may lead to disease relapse. In the present study, we identified AKR1C3, an
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.