콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU102911

Sigma-Aldrich

MISSION® esiRNA

targeting human RACK1

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

CTGAGTGTGGCCTTCTCCTCTGACAACCGGCAGATTGTCTCTGGATCTCGAGATAAAACCATCAAGCTATGGAATACCCTGGGTGTGTGCAAATACACTGTCCAGGATGAGAGCCACTCAGAGTGGGTGTCTTGTGTCCGCTTCTCGCCCAACAGCAGCAACCCTATCATCGTCTCCTGTGGCTGGGACAAGCTGGTCAAGGTATGGAACCTGGCTAACTGCAAGCTGAAGACCAACCACATTGGCCACACAGGCTATCTGAACACGGTGACTGTCTCTCCAGATGGATCCCTCTGTGCTTCTGGAGGCAAGGATGGCCAGGCCATGTTATGGGATCTCAACGAAGGCAAACACCTTTACACGCTAGATGGTGGGGACATCATCAACGCCCTGTGCTTCAGCCCTAACCGCTACTGGCTGTGTG

Ensembl | 인체 수납 번호

ENSG00000204628

NCBI 수납 번호

NM_006098

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... RACK1(10399) , GNB2L1(10399)

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number
NLU
GZT
QHS

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

COA 검색

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Lei Zhang et al.
OncoTargets and therapy, 12, 1007-1020 (2019-02-19)
The expression and function of the Receptor for Activated C Kinase 1 (RACK1) in cancer growth and metastasis are confused in different cancers, especially in pancreatic ductal adenocarcinoma (PDAC). One-hundred and eighty-two PDAC tissue specimens (95 males and 87 females)
Yi Hu et al.
Cancer letters, 450, 144-154 (2019-03-09)
Receptor of activated protein kinase C 1 (RACK1) is downregulated in gastric cancer and is involved in modulating NF-κB signaling pathway activity. However, the underlying molecular mechanisms regulating RACK1 expression are unclear. In this study, we demonstrated that downregulated expression
Wenting He et al.
Journal of Alzheimer's disease : JAD, 75(2), 451-460 (2020-04-07)
Accumulation of amyloid-β (Aβ) peptides, generated from amyloid-β precursor protein (AβPP) amyloidogenic processing, is one of the most salient disease hallmarks of Alzheimer's disease (AD). Nicotine is able to promote α-secretase-mediated AβPP nonamyloidogenic processing and increase the release of sAβPPα
Zhao-Fei Dong et al.
Molecular neurobiology, 50(2), 438-448 (2014-01-18)
Voltage-gated sodium channel α subunit type I (Nav1.1, encoded by SCN1A gene) plays a critical role in the initiation of action potential in the central nervous system. Downregulated expression of SCN1A is believed to be associated with epilepsy. Here, we
Li-Tao Liu et al.
British journal of pharmacology, 177(7), 1609-1621 (2019-11-21)
Autophagy is a critical cellular catabolic process in cell homoeostasis and brain function. Recent studies indicate that receptor for activated C kinase 1 (RACK1) is involved in autophagosome formation in Drosophila and mice, and that it plays an essential role
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.