콘텐츠로 건너뛰기
Merck
모든 사진(1)

Key Documents

EHU100971

Sigma-Aldrich

MISSION® esiRNA

targeting human PRC1

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

GGACCAGCGGTTACAAAGAACTGAGGTGGTAAAGAAGCATATCAAGGAACTCCTGGATATGATGATTGCTGAAGAGGAAAGCCTGAAGGAAAGACTCATCAAAAGCATATCCGTCTGTCAGAAAGAGCTGAACACTCTGTGCAGCGAGTTACATGTTGAGCCATTTCAGGAAGAAGGAGAGACGACCATCTTGCAACTAGAAAAAGATTTGCGCACCCAAGTGGAATTGATGCGAAAACAG

Ensembl | 인체 수납 번호

ENSG00000198901

NCBI 수납 번호

NM_003981

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... PRC1(9055) , PRC1(9055)

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Tianxiang Xu et al.
Cancer cell international, 20(1), 528-528 (2020-12-10)
Protein regulator of cytokinesis 1 (PRC1) has been reported to play important role in the pathogenesis of various cancers. However, its role in colon cancer has not been studied. Here, we aimed to investigate the biological functions and potential mechanism
Bin Zhang et al.
Journal of cellular and molecular medicine, 21(7), 1329-1341 (2017-02-13)
Gastric carcinoma is one of the most common malignancies worldwide and the second most frequent cause of cancer-related death in China. Protein regulator of cytokinesis 1 (PRC1) is involved in cytokinesis and plays key roles in microtubule organization in eukaryotes.
Melissa C Pamula et al.
The Journal of cell biology, 218(8), 2529-2544 (2019-06-30)
In the spindle midzone, microtubules from opposite half-spindles form bundles between segregating chromosomes. Microtubule bundles can either push or restrict chromosome movement during anaphase in different cellular contexts, but how these activities are achieved remains poorly understood. Here, we use

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.