설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
형태
lyophilized powder
esiRNA cDNA 표적 서열
TTTGAAGGAGCTGAGCGAGTCGGTCCAGCAACAGTCCACCCCTGTTCCTCTCATCTCTCCCAAGCGCCAGATTCGTAGCAGGTTCCAGCTGAATCTTGACAAGACCATAGAGAGTTGCAAAGCACAATTAGGCATAAATGAAATCTCGGAAGATGTCTATACGGCCGTAGAGCACAGCGATTCGGAGGATTCTGAGAAGTCAGATAGTAGCGATAGTGAGTATATCAGTGATGATGAGCAGAAGTCTAAGAACGAGCCAGAAGACACAGAGGACAAAGAAGGTTGTCAGATGGACAAAGAGCCATCTGC
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... ZMYND8(23613) , ZMYND8(23613)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
시험 성적서(COA)
제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.
Shravanti Mukherjee et al.
Cell death & disease, 11(12), 1073-1073 (2020-12-17)
The major challenge in chemotherapy lies in the gain of therapeutic resistance properties of cancer cells. The relatively small fraction of chemo-resistant cancer cells outgrows and are responsible for tumor relapse, with acquired invasiveness and stemness. We demonstrate that zinc-finger
Moitri Basu et al.
Biochimica et biophysica acta, 1860(4), 450-459 (2017-02-25)
All trans retinoic acid (ATRA), an active vitamin-A derivative, has been shown to regulate gene expression program and thus imparts anti-proliferative activity to cancer cells. Previously, we identified a dual histone reader ZMYND8 (zinc finger MYND (Myeloid, Nervy and DEAF-1)-type
Moitri Basu et al.
The Biochemical journal, 474(11), 1919-1934 (2017-04-23)
Enhanced migratory potential and invasiveness of cancer cells contribute crucially to cancer progression. These phenotypes are achieved by precise alteration of invasion-associated genes through local epigenetic modifications which are recognized by a class of proteins termed a chromatin reader. ZMYND8
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.