콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU096691

Sigma-Aldrich

MISSION® esiRNA

targeting human ADARB1

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

AATCACGAGGGCTACTGCACAATACATGGCCTAAGTTCCCTCTGTTCCTTCCTCTGAATCGAATGGATGTGGGTGACCGCCCGAAGGCCTTCACAGGATGGAAGTAGAATGATTTCAGTAGATACTCATTCTTGGAAAATGCCATAGTTTTAAATTATTGTTTCCAGCTTTATCAAAGACATGTTTGAAAAATAAAAAGCATCCAAGTGAGAGCTGGTGAGACCACGTGCTGCTGGCGTAGTGTAGGCCAGACATTGACAGTCCTGACGGGAGCTCAGGGCTGCCCAGCGCCCAGCGTGCACGGGACGGCCCCACGACAGAGGGAGTCAGCC

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

관련 카테고리

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Tingting Yue et al.
Neurochemistry international, 129, 104479-104479 (2019-05-31)
Previously we reported that gene expression of astrocytic 5-HT2B receptors was decreased in brains of depressed animals exposed to chronic mild stress (CMS) (Li et al., 2012) and of Parkinson's disease (Song et al., 2018). Depression is also one of
Zexiong Li et al.
Neurochemistry international, 134, 104689-104689 (2020-01-23)
The alcoholism and major depressive disorder are common comorbidity, with alcohol-induced depressive symptoms being eased by selective serotonin re-uptake inhibitors (SSRIs), although the mechanisms underlying pathology and therapy are poorly understood. Chronic alcohol consumption affects the activity of serotonin 2C
Tatiana Altadill et al.
Scientific reports, 7(1), 8803-8803 (2017-08-20)
Endometrial cancer (EC) remains the most common malignancy of the genital tract among women in developed countries. Although much research has been performed at genomic, transcriptomic and proteomic level, there is still a significant gap in the metabolomic studies of

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.