설명
Powered by Eupheria Biotech
제품 라인
MISSION®
형태
lyophilized powder
esiRNA cDNA 표적 서열
GCAAGCAACTTTGACTGCTGTCTTGGATACACAGACCGTATTCTTCATCCTAAATTTATTGTGGGCTTCACACGGCAGCTGGCCAATGAAGGCTGTGACATCAATGCTATCATCTTTCACACAAAGAAAAAGTTGTCTGTGTGCGCAAATCCAAAACAGACTTGGGTGAAATATATTGTGCGTCTCCTCAGTAAAAAAGTCAAGAACATGTAAAAACTGTGGCTTTTCTGGAATGGAATTGGACATAGCCCAAGAACAGAAAGAACCTTGCTGGGGTTGGAGGTTTCACTTGCACATCATGGAGGGTTTAGTGCTTATCTAATTTGTGCCTCACTGGACTTG
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... CCL20(6364) , CCL20(6364)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
시험 성적서(COA)
제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.
Aging, 12(14), 14849-14862 (2020-06-24)
Recent evidence suggests that CC chemokine ligand 20 (CCL20) is upregulated after subarachnoid hemorrhage (SAH). Here, we investigated the functions of CCL20 in SAH injury and its underlying mechanisms of action. We found that CCL20 is upregulated in an SAH
Biotechnology letters, 43(2), 393-405 (2020-11-10)
Myocardial infarction (MI) is a prevalent cardiovascular puzzle and a mainspring of disease-induced mortality. We performed this investigation to detect the role of putative important miRNAs or genes in MI. CCL20 may be a potential therapeutic target, which was directly
The Journal of experimental medicine, 208(1), 103-114 (2011-01-12)
Cognate antigen recognition by CD4(+) T cells is thought to contribute to the tissue specificity of various autoimmune diseases, particularly those associated with class II MHC alleles. However, we show that localized class II MHC-dependent arthritis in F759 mice depends
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.