설명
Powered by Eupheria Biotech
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
TGTTGTTCAATGAATTGGCTTTCTTTAAGCTTATGCAAGATTTGGATAATAATAGTATAACTGTTAAACAGAGATGCAAAAGGAAAATAGAAGCAACTGGAGTGATACAATCTTGTGCCAAAGAGGCTAAAAGGATTCTTGAAGATCATGGCTCACCTGCTGGAGAGATTGATGATGAAGACAAAGACAAGGATGAAACTGAAACAGTTAAGCAGACTCAAACATCTGAGGTGTATGATGGTCCCAAAAATGTAAGATCTGATATTTCTGATCAAGAGGAAGATGAAGAAAGTGAAGGATGTCCA
Ensembl | 인체 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... PCM1(5108) , PCM1(5108)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
H Kubra Gurkaslar et al.
Cell reports, 31(6), 107630-107630 (2020-05-14)
Centrosomes function in key cellular processes ranging from cell division to cellular signaling. Their dysfunction is linked to cancer and developmental disorders. Here, we identify CCDC57 as a pleiotropic regulator of centriole duplication, mitosis, and ciliogenesis. Combining proximity mapping with
Xin Li et al.
Nature communications, 8, 14866-14866 (2017-04-01)
Defective centrosome duplication is implicated in microcephaly and primordial dwarfism as well as various ciliopathies and cancers. Yet, how the centrosome biogenesis is regulated remains poorly understood. Here we report that the X-linked deubiquitinase USP9X is physically associated with centriolar
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.