콘텐츠로 건너뛰기
Merck
모든 사진(1)

문서

EHU095241

Sigma-Aldrich

MISSION® esiRNA

targeting human FGFR3 (1)

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

GTGTGCAGGTTCCGATGTTATTAGATGTTACAAGTTTATATATATCTATATATATAATTTATTGAGTTTTTACAAGATGTATTTGTTGTAGACTTAACACTTCTTACGCAATGCTTCTAGAGTTTTATAGCCTGGACTGCTACCTTTCAAAGCTTGGAGGGAAGCCGTGAATTCAGTTGGTTCGTTCTGTACTGTTACTGGGCCCTGAGTCTGGGCAGCTGTCCCTTGCTTGCCTGCAGGGCCATGGCTCAGGGTGGTCTCTTCTTGGGGCCCAGTGCATGGTGGCCAGAGGTGTCACCCAAACCG

Ensembl | 인체 수납 번호

ENSG00000068078

NCBI 수납 번호

NM_000142

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... FGFR3(2261) , FGFR3(2261)

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Josine M Quispel-Janssen et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 24(1), 84-94 (2017-10-25)
Purpose: Despite intense research, treatment options for patients with mesothelioma are limited and offer only modest survival advantage. We screened a large panel of compounds in multiple mesothelioma models and correlated sensitivity with a range of molecular features to detect
Evan K Day et al.
Cell reports, 30(10), 3383-3396 (2020-03-12)
SPRY2 is a purported tumor suppressor in certain cancers that promotes tumor growth and resistance to receptor tyrosine kinase inhibitors in glioblastoma. Here, we identify a SPRY2-dependent bypass signaling mechanism in glioblastoma that drives resistance to EGFR and MET inhibition.
Xina Xie et al.
Experimental and therapeutic medicine, 18(2), 1226-1234 (2019-07-19)
Fibroblast growth factor receptor 3 (FGFR3) is a high frequency mutant gene in bladder cancer (BCa) and has become a promising therapeutic target due to its involvement in cell proliferation and migration. However, whether and how FGFR3 mutations affects BCa
Takeshi Okada et al.
Molecular neurobiology, 56(12), 8203-8219 (2019-06-17)
Neuronal apoptosis is a common and critical pathology following subarachnoid hemorrhage (SAH). We investigated the anti-apoptotic property of fibroblast growth factor (FGF)-2 after SAH in rats. A total of 289 rats underwent endovascular perforation to induce SAH or sham operation.
V Tassinari et al.
Cell death & disease, 6, e1688-e1688 (2015-03-15)
Both fibroblast growth factor 9 (Fgf9) and Kit Ligand (Kl) signal through tyrosine kinase receptors, yet they exert opposite effects on meiotic differentiation in postnatal spermatogonia, Fgf9 acting as a meiosis-inhibiting substance and Kl acting as a promoter of the
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.