설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
형태
lyophilized powder
esiRNA cDNA 표적 서열
CTTTGGACTCAAGGCTGAGGCAGCCCCCACTCTGCGCTTGGTCAACCTTGAAACCACTAAGAAGTATGCGCCTGTGGATGGGGGCCCTGTCACCGCAGCGTCCATCACTGCTTTCTGCCATGCAGTCCTCAACGGCCAAGTCAAGCCCTATCTCCTGAGCCAGGAGATACCCCCTGATTGGGATCAGCGGCCAGTTAAGACCCTCGTGGGCAAGAATTTTGAGCAGGTGGCTTTTGACGAAACCAAGAATGTGTTTGTCAAGTTCTATGCCCCGTGGTGCACCCACTGCAAGGAGATGGCCCCTGCCTGGGAGGCATTGGCTGAGAAGTACCAAGACCACGAGGACATC
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... PDIA2(64714) , PDIA2(64714)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
시험 성적서(COA)
제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.
Thrombosis and haemostasis, 113(4), 891-902 (2015-01-30)
Protein-disulphide isomerase family (PDI) are an ER-stress protein that controls TF-procoagulant activity but its role in HVSMC migration and coronary artery disease remains to be elucidated. We aimed to investigate whether in human coronary smooth muscle cells (HVSMC) the ER-stress
Journal of virology, 89(17), 8897-8908 (2015-06-19)
The nonenveloped polyomavirus (PyV) simian virus 40 (SV40) traffics from the cell surface to the endoplasmic reticulum (ER), where it penetrates the ER membrane to reach the cytosol before mobilizing into the nucleus to cause infection. Prior to ER membrane
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.