콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU094671

Sigma-Aldrich

MISSION® esiRNA

targeting human TDP1

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

GCAATGCCATGCCACATATTAAGACATATATGAGGCCTTCTCCAGACTTCAGTAAAATTGCTTGGTTCCTTGTCACAAGCGCAAATCTGTCCAAGGCTGCCTGGGGAGCATTGGAGAAGAATGGCACCCAGCTGATGATCCGCTCCTACGAGCTCGGGGTCCTTTTCCTCCCTTCAGCATTTGGTCTAGACAGTTTCAAAGTGAAACAGAAGTTCTTCGCTGGCAGCCAGGAGCCAATGGCCACCTTTCCTGTGCCATATGATTTGCCTCCAGAACTGTATGGAAGTAAAGATCGGCCATGGATATGGAACATTCCTTATGTCAAAGCACCGGATACGCATGGGAACATGTGGGTGCCCTCCTGAGAATCTTGAGGCACTGTGAAATTTAAGTGTAAGACATTGAGCCACAAACATGGAATC

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Benu Brata Das et al.
Nucleic acids research, 42(7), 4435-4449 (2014-02-05)
Poly(ADP-ribose) polymerases (PARP) attach poly(ADP-ribose) (PAR) chains to various proteins including themselves and chromatin. Topoisomerase I (Top1) regulates DNA supercoiling and is the target of camptothecin and indenoisoquinoline anticancer drugs, as it forms Top1 cleavage complexes (Top1cc) that are trapped
Alejandro Álvarez-Quilón et al.
Molecular cell, 78(6), 1152-1165 (2020-06-10)
The APEX2 gene encodes APE2, a nuclease related to APE1, the apurinic/apyrimidinic endonuclease acting in base excision repair. Loss of APE2 is lethal in cells with mutated BRCA1 or BRCA2, making APE2 a prime target for homologous recombination-defective cancers. However
Sourav Saha et al.
Cell reports, 33(13), 108569-108569 (2020-12-31)
The present study demonstrates that topoisomerase 3B (TOP3B) forms both RNA and DNA cleavage complexes (TOP3Bccs) in vivo and reveals a pathway for repairing TOP3Bccs. For inducing and detecting cellular TOP3Bccs, we engineer a "self-trapping" mutant of TOP3B (R338W-TOP3B). Transfection with
Curtis W Bacon et al.
Molecular cell, 78(6), 1133-1151 (2020-05-14)
Precise control of the RNA polymerase II (RNA Pol II) cycle, including pausing and pause release, maintains transcriptional homeostasis and organismal functions. Despite previous work to understand individual transcription steps, we reveal a mechanism that integrates RNA Pol II cycle

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.