설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
GCAATGCCATGCCACATATTAAGACATATATGAGGCCTTCTCCAGACTTCAGTAAAATTGCTTGGTTCCTTGTCACAAGCGCAAATCTGTCCAAGGCTGCCTGGGGAGCATTGGAGAAGAATGGCACCCAGCTGATGATCCGCTCCTACGAGCTCGGGGTCCTTTTCCTCCCTTCAGCATTTGGTCTAGACAGTTTCAAAGTGAAACAGAAGTTCTTCGCTGGCAGCCAGGAGCCAATGGCCACCTTTCCTGTGCCATATGATTTGCCTCCAGAACTGTATGGAAGTAAAGATCGGCCATGGATATGGAACATTCCTTATGTCAAAGCACCGGATACGCATGGGAACATGTGGGTGCCCTCCTGAGAATCTTGAGGCACTGTGAAATTTAAGTGTAAGACATTGAGCCACAAACATGGAATC
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... TDP1(55775) , TDP1(55775)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Benu Brata Das et al.
Nucleic acids research, 42(7), 4435-4449 (2014-02-05)
Poly(ADP-ribose) polymerases (PARP) attach poly(ADP-ribose) (PAR) chains to various proteins including themselves and chromatin. Topoisomerase I (Top1) regulates DNA supercoiling and is the target of camptothecin and indenoisoquinoline anticancer drugs, as it forms Top1 cleavage complexes (Top1cc) that are trapped
Alejandro Álvarez-Quilón et al.
Molecular cell, 78(6), 1152-1165 (2020-06-10)
The APEX2 gene encodes APE2, a nuclease related to APE1, the apurinic/apyrimidinic endonuclease acting in base excision repair. Loss of APE2 is lethal in cells with mutated BRCA1 or BRCA2, making APE2 a prime target for homologous recombination-defective cancers. However
Sourav Saha et al.
Cell reports, 33(13), 108569-108569 (2020-12-31)
The present study demonstrates that topoisomerase 3B (TOP3B) forms both RNA and DNA cleavage complexes (TOP3Bccs) in vivo and reveals a pathway for repairing TOP3Bccs. For inducing and detecting cellular TOP3Bccs, we engineer a "self-trapping" mutant of TOP3B (R338W-TOP3B). Transfection with
Curtis W Bacon et al.
Molecular cell, 78(6), 1133-1151 (2020-05-14)
Precise control of the RNA polymerase II (RNA Pol II) cycle, including pausing and pause release, maintains transcriptional homeostasis and organismal functions. Despite previous work to understand individual transcription steps, we reveal a mechanism that integrates RNA Pol II cycle
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.