콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU094261

Sigma-Aldrich

MISSION® esiRNA

targeting human DUOX1

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

ACAAGGATGGCAATGGCTACCTGTCCTTCCGAGAGTTCCTGGACATCCTGGTGGTCTTCATGAAAGGCTCTCCTGAGGAAAAGTCTCGCCTTATGTTCCGCATGTACGACTTTGATGGGAATGGCCTCATTTCCAAGGATGAGTTCATCAGGATGCTGAGATCCTTCATCGAGATCTCCAACAACTGCCTGTCCAAGGCCCAGCTGGCTGAGGTGGTGGAGTCCATGTTCCGGGAGTCGGGATTCCAGGACAAGGAGGAACTGACATGGGAAGATTTTCACTTCATGCTGCGGGACCACAATAGCGAGCTCCGCTTCACGCAGCTCTGTGTCAAAGGGGTGGAGGTGCCTGAAGTCATCAAGGACCTCTGCCGGCGAGCCTCCTACATCAGCCAGGATATGATCTGTCCCTCTCCCAGAGTG

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

관련 카테고리

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Sergio Candel et al.
PLoS biology, 12(5), e1001855-e1001855 (2014-05-08)
TNFα overexpression has been associated with several chronic inflammatory diseases, including psoriasis, lichen planus, rheumatoid arthritis, and inflammatory bowel disease. Paradoxically, numerous studies have reported new-onset psoriasis and lichen planus following TNFα antagonist therapy. Here, we show that genetic inhibition
Rabii Ameziane-El-Hassani et al.
Proceedings of the National Academy of Sciences of the United States of America, 112(16), 5051-5056 (2015-04-08)
Ionizing radiation (IR) causes not only acute tissue damage, but also late effects in several cell generations after the initial exposure. The thyroid gland is one of the most sensitive organs to the carcinogenic effects of IR, and we have
Zhimin Feng et al.
Infection and immunity, 82(11), 4458-4465 (2014-08-13)
Currently, Acinetobacter baumannii is recognized as one of the major pathogens seriously threatening our health care delivery system. Aspects of the innate immune response to A. baumannii infection are not yet well understood. Human β-defensins (hBDs) are epithelial cell-derived cationic

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.