설명
Powered by Eupheria Biotech
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
ACAAGGATGGCAATGGCTACCTGTCCTTCCGAGAGTTCCTGGACATCCTGGTGGTCTTCATGAAAGGCTCTCCTGAGGAAAAGTCTCGCCTTATGTTCCGCATGTACGACTTTGATGGGAATGGCCTCATTTCCAAGGATGAGTTCATCAGGATGCTGAGATCCTTCATCGAGATCTCCAACAACTGCCTGTCCAAGGCCCAGCTGGCTGAGGTGGTGGAGTCCATGTTCCGGGAGTCGGGATTCCAGGACAAGGAGGAACTGACATGGGAAGATTTTCACTTCATGCTGCGGGACCACAATAGCGAGCTCCGCTTCACGCAGCTCTGTGTCAAAGGGGTGGAGGTGCCTGAAGTCATCAAGGACCTCTGCCGGCGAGCCTCCTACATCAGCCAGGATATGATCTGTCCCTCTCCCAGAGTG
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... DUOX1(53905) , DUOX1(50506)
관련 카테고리
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Sergio Candel et al.
PLoS biology, 12(5), e1001855-e1001855 (2014-05-08)
TNFα overexpression has been associated with several chronic inflammatory diseases, including psoriasis, lichen planus, rheumatoid arthritis, and inflammatory bowel disease. Paradoxically, numerous studies have reported new-onset psoriasis and lichen planus following TNFα antagonist therapy. Here, we show that genetic inhibition
Rabii Ameziane-El-Hassani et al.
Proceedings of the National Academy of Sciences of the United States of America, 112(16), 5051-5056 (2015-04-08)
Ionizing radiation (IR) causes not only acute tissue damage, but also late effects in several cell generations after the initial exposure. The thyroid gland is one of the most sensitive organs to the carcinogenic effects of IR, and we have
Zhimin Feng et al.
Infection and immunity, 82(11), 4458-4465 (2014-08-13)
Currently, Acinetobacter baumannii is recognized as one of the major pathogens seriously threatening our health care delivery system. Aspects of the innate immune response to A. baumannii infection are not yet well understood. Human β-defensins (hBDs) are epithelial cell-derived cationic
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.