콘텐츠로 건너뛰기
Merck
모든 사진(1)

문서

EHU093341

Sigma-Aldrich

MISSION® esiRNA

targeting human BBC3

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

TGAGCCAAACGTGACCACTAGCCTCCTGGAGCCAGAGAGTGGGGCTCGTTTGCCGGTTGCTCCAGCCCGGCGCCCAGCCATCTTCCCTGAGCCAGCCGGCGGGTGGTGGGCATGCCTGCCTCACCTTCATCAGGGGGTGGCCAGGAGGGGCCCAGACTGTGAATCCTGTGCTCTGCCCGTGACCGCCCCCCGCCCCATCAATCCCATTGCATAGGTTTAGAGAGAGCACGTGTGACCACTGGCATTCATTTGGGGGGTGGGAGATTTTGGCTGAAGCCGCCCCAGCCTTAGTCCCCAGGGCCAAGCGCTGGGGGGAAGACGGGGAGTCAGGGAGGGGGGGAAATCTCGGAAGAGGGAGGAGTCTGGGAGTGGGGAGGGATGGCCCAGCCTGTAAGATACTGTATATGCGCTGCTGTAGATACCG

Ensembl | 인체 수납 번호

ENSG00000105327

NCBI 수납 번호

NM_014417

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... BBC3(27113) , BBC3(27113)

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

S-G Xing et al.
European review for medical and pharmacological sciences, 22(13), 4341-4349 (2018-07-20)
Propofol is one of the most commonly used intravenous anesthetic agents used in cancer resections, but the effect of propofol on non-small cell lung cancer (NSCLC) remains unclear. Previous researches have reported that propofol can inhibit extracellular signal-regulated kinase (ERK)
Yu Li et al.
Cancer biomarkers : section A of Disease markers, 20(2), 175-181 (2017-09-05)
Studies in developing animals have demonstrated that when anesthetic agents, such as propofol, are early administered in life, it can lead to neuronal cell death and learning disabilities. However, the mechanisms causing these effects remains unknown. A recent report found that
Longwei Huo et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 92, 347-355 (2017-05-30)
Glioma is the most common primary malignant tumor of the central nervous system. B10 is a new glycosylated derivative of betulinic acid with enhanced cytotoxic activity. The present study was designed to explore the molecular mechanism underlying the anticancer effect
Wenyi Liu et al.
Bioengineered, 11(1), 189-200 (2020-02-14)
MicroRNAs (miRNAs) have emerged as critical regulators of neuronal survival during cerebral ischemia/reperfusion injury. Accumulating evidence has shown that miR-211 plays a crucial role in regulating apoptosis and survival in various cell types. However, whether miR-211 is involved in regulating
Lin Wang et al.
Journal of Asian natural products research, 19(6), 630-643 (2017-04-26)
The aim of this study is to investigate the synergism of low dose of actinomycin D (LDActD) to the cytotoxicity of cisplatin (CDDP) on KB cells. The role of P53 reactivation by LDActD in the synergism and its mechanism were
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.