설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
TTGGTGGAGAAATTGTGCATATGCCAATTTTTTGTTAAAACCTTTTGTTTTGAACTATACTGCTTTGAGATCTCATTTCAGAAGAACGGCATGAACAGTCTTCAGCCACAGTTGTGATGGTTGTTAAATGCTCACAATTGTGCATTCTTAGGGTTTTTCCATCCCTGGGGTTTGCAAGTTGTTCACTTAAAACATTCTTAAAATGGTTGGCTTCTTGTCTGCAAGCCAGCTGATATGGTAGCAACCAAAGATTCCAGTGTTTGAGCATATGAAAGACTCTGCCTGCTTAATTGTGCTAGAAATAACAGCATCTAAAGTGAAGACTTAAGAAAAACTTAGTGACTACTAGATTATCCTTAGGACTCTGCATTAACTCTATAATGTTCTTGGTATTAAAAAAAAAGCATATTTGTCACAGAAATTT
Ensembl | 인체 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... CSNK1A1(1452) , CSNK1A1(122011)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Luke J Fulcher et al.
EMBO reports, 20(9), e47495-e47495 (2019-07-25)
The concerted action of many protein kinases helps orchestrate the error-free progression through mitosis of mammalian cells. The roles and regulation of some prominent mitotic kinases, such as cyclin-dependent kinases, are well established. However, these and other known mitotic kinases
Xia Liu et al.
Oncogene, 39(1), 176-186 (2019-08-30)
Somatic missense mutations of the CSNK1A1 gene encoding casein kinase 1 alpha (CK1α) occur in a subset of myelodysplastic syndrome (MDS) with del(5q) karyotype. The chromosomal deletion causes CSNK1A1 haplo-insufficiency. CK1α mutations have also been observed in a variety of
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.