콘텐츠로 건너뛰기
Merck
모든 사진(1)

문서

EHU093121

Sigma-Aldrich

MISSION® esiRNA

targeting human CTTN

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

CTTGGGAAGGAAGGCAGTGCCTGCTCTGCTGTGAGCCGCCAGGAACCCTCCTCCTGTCAATGGGGGTGTAGTATTTTTGCCAAAATATCATGTTCAATTTCAGTAGTTTGATCAGTTGAAGGCTAGAAGTGTGAAGTGCAGATGAGTGTGTGTTCTTCCCCAAGGTCCCCCCACAGCTCCAGGACACCGCTGTCCTGGCATTTGTGGCCACTCACTTTGTAGGAAACTCATCTCCTTCCTGAGGAGCCGGGAGGCTGGACCAGTCCCGTCGTGCAGTCAGGTGGGCGGTGTGTCTTTCCAGAAGGTCACGTGGAAATGTCTCGGGACTTGGGTCCCGGAGTGCCCGTGAAGCGTGTTTTTGCTCCTGAGGTGCATTTTCTCATCATCCTTGCTTTACCACAATGAGCAATGAGGTCGGGTTTTA

Ensembl | 인체 수납 번호

ENSG00000085733

NCBI 수납 번호

NM_138565

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... CTTN(2017) , CTTN(2017)

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Xiaojian Zhang et al.
Oncotarget, 8(1), 1541-1554 (2016-12-03)
Cortactin (CTTN) is overexpressed in various tumors, including head and neck squamous cell carcinoma and colorectal cancer (CRC), and can serve as a biomarker of cancer metastasis. We observed that CTTN promotes cancer cell proliferation in vitro and increases CRC
Rachel J Watkins et al.
The Journal of clinical endocrinology and metabolism, 101(12), 4551-4563 (2016-09-08)
Metastatic disease is responsible for the majority of endocrine cancer deaths. New therapeutic targets are urgently needed to improve patient survival rates. The proto-oncogene PTTG1-binding factor (PBF/PTTG1IP) is overexpressed in multiple endocrine cancers and circumstantially associated with tumor aggressiveness. This
Steven M Markwell et al.
Molecular cancer research : MCR, 17(4), 987-1001 (2019-01-06)
Malregulation of the actin cytoskeleton enhances tumor cell motility and invasion. The actin-binding protein cortactin facilitates branched actin network formation through activation of the actin-related protein (Arp) 2/3 complex. Increased cortactin expression due to gene amplification is observed in head
Dominik Horn et al.
Head & neck, 40(12), 2685-2694 (2018-11-21)
Cortactin (CTTN) is located on chromosome 11q13 and is associated with invasiveness in various cancer entities. CTTN protein expression could be a prognosticator of oral squamous cell carcinoma (OSCC) in terms of recurrence and survival. CTTN-dependent invasion was performed using
Xuan Liang et al.
Nature communications, 8(1), 790-790 (2017-10-07)
Contractile adherens junctions support cell-cell adhesion, epithelial integrity, and morphogenesis. Much effort has been devoted to understanding how contractility is established; however, less is known about whether contractility can be actively downregulated at junctions nor what function this might serve.
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.