설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
형태
lyophilized powder
esiRNA cDNA 표적 서열
AACACGGAGCTCAAGGAGAACCTGAAGGACACCATGACCAAGCGCTACCACCAGCCGGGCCATGAGGCTGTGACCAGCGCTGTGGACCAGCTGCAGCAGGAGTTCCACTGCTGTGGCAGCAACAACTCACAGGACTGGCGAGACAGTGAGTGGATCCGCTCACAGGAGGCCGGTGGCCGTGTGGTCCCAGACAGCTGCTGCAAGACGGTGGTGGCTCTTTGTGGGCAGCGAGACCATGCCTCCAACATCTACAAGGTGGAGGGCGGCTGCATCACCAAGTTGGAGACCTTCATCCAGGAGCACCTGAGGGTCATTGGGGCTGTGGGGATCGGCATTGCCTGTGTGCAGGTCTTTGGCATGATCTTCACGTGCTGCCTGTAC
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... CD151(977) , CD151(977)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
시험 성적서(COA)
제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.
Laura A Fast et al.
International journal of molecular sciences, 19(10) (2018-10-04)
Tetraspanins are suggested to regulate the composition of cell membrane components and control intracellular transport, which leaves them vulnerable to utilization by pathogens such as human papillomaviruses (HPV) and cytomegaloviruses (HCMV) to facilitate host cell entry and subsequent infection. In
Yongkang Qiao et al.
The Journal of allergy and clinical immunology, 141(5), 1799-1817 (2017-12-24)
Despite advances in our understanding of the mechanisms of influenza A virus (IAV) infection, the crucial virus-host interactions during the viral replication cycle still remain incomplete. Tetraspanin CD151 is highly expressed in the human respiratory tract, but its pathological role in
Yongkang Qiao et al.
The Journal of allergy and clinical immunology, 139(1), 82-92 (2016-05-29)
Airway smooth muscle (ASM) contraction underpins airway constriction; however, underlying mechanisms for airway hyperresponsiveness (AHR) remain incompletely defined. CD151, a 4-transmembrane glycoprotein that associates with laminin-binding integrins, is highly expressed in the human lung. The role of CD151 in ASM
Jérôme Finke et al.
Scientific reports, 10(1), 5356-5356 (2020-03-27)
During cell invasion, human papillomaviruses use large CD151 patches on the cell surface. Here, we studied whether these patches are defined architectures with features for virus binding and/or internalization. Super-resolution microscopy reveals that the patches are assemblies of closely associated
Soonyean Hwang et al.
Cellular and molecular life sciences : CMLS, 76(8), 1595-1604 (2019-02-20)
Tetraspanin protein CD151 has typically been studied as binding partner and functional regulator of laminin-binding integrins. However, we show here that CD151 supports anti-cancer drug resistance independent of integrins. CD151 ablation sensitized multiple tumor cell types to several anti-cancer drugs
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.