콘텐츠로 건너뛰기
Merck
모든 사진(1)

문서

EHU092651

Sigma-Aldrich

MISSION® esiRNA

targeting human ACACA (1)

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

AGAGGGTGCGTTTCAATCAGATGCTTCTGGAACGTCGAAATTGTCTTCTTTGGAAAGAACCATCCCCTCTTTGGGCTTCAGAGGCCCAAATTGAGGCGCAATGATGAGAGGATGTGGTGGTCTACTCTGATGTCAATCTTGAGGGCTAGGTCTTTCTGGAAGTGGATATCTACTCAGACAGTAAGAATTATAAGAGCTGTAAGAGCTCATTTTGGAGGAATAATGGATGAACCATCTCCCTTGGCCCAACCTCTGGAGCTGAACCAGCACTCTCGATTCATAATAGGTTCTGTGTCTGAAGATAACTCAGAGGATGAGATCAGCAACCTGGTGAAGTTGGACCTACTGGAGGAGAAGGAGGGCTCCTTGTCACCTGCTTCTGTTGG

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Maosong Ye et al.
Journal of thoracic disease, 8(8), 1943-1955 (2016-09-14)
Lung cancer is the leading cause of cancer-related death worldwide. Patients with lung cancer are very frequently present with pulmonary infections, in particular with Gram-negative bacteria. Herein, we investigated the effect of the co-presence of Gram-negative bacteria on outgrowth and
Bingyu Ye et al.
Molecular medicine reports, 19(5), 3431-3440 (2019-03-01)
Acetyl‑coenzyme A carboxylase 1 (ACC1) serves a major role in fatty acid synthesis. Previous reports have indicated that ACC1 is a promising drug target for treating human diseases, particularly cancers and metabolic diseases; however, the role of ACC1 in liver
Wenjuan Li et al.
Molecular carcinogenesis, 55(11), 1739-1746 (2015-10-17)
Withaferin A (WA), a natural product derived from Withania somnifera, has been used in traditional oriental medicines to treat neurological disorders. Recent studies have demonstrated that this compound may have a potential for cancer treatment and a clinical trial has

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.