설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
형태
lyophilized powder
esiRNA cDNA 표적 서열
AGAGGGTGCGTTTCAATCAGATGCTTCTGGAACGTCGAAATTGTCTTCTTTGGAAAGAACCATCCCCTCTTTGGGCTTCAGAGGCCCAAATTGAGGCGCAATGATGAGAGGATGTGGTGGTCTACTCTGATGTCAATCTTGAGGGCTAGGTCTTTCTGGAAGTGGATATCTACTCAGACAGTAAGAATTATAAGAGCTGTAAGAGCTCATTTTGGAGGAATAATGGATGAACCATCTCCCTTGGCCCAACCTCTGGAGCTGAACCAGCACTCTCGATTCATAATAGGTTCTGTGTCTGAAGATAACTCAGAGGATGAGATCAGCAACCTGGTGAAGTTGGACCTACTGGAGGAGAAGGAGGGCTCCTTGTCACCTGCTTCTGTTGG
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
시험 성적서(COA)
제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.
Journal of thoracic disease, 8(8), 1943-1955 (2016-09-14)
Lung cancer is the leading cause of cancer-related death worldwide. Patients with lung cancer are very frequently present with pulmonary infections, in particular with Gram-negative bacteria. Herein, we investigated the effect of the co-presence of Gram-negative bacteria on outgrowth and
Molecular medicine reports, 19(5), 3431-3440 (2019-03-01)
Acetyl‑coenzyme A carboxylase 1 (ACC1) serves a major role in fatty acid synthesis. Previous reports have indicated that ACC1 is a promising drug target for treating human diseases, particularly cancers and metabolic diseases; however, the role of ACC1 in liver
Molecular carcinogenesis, 55(11), 1739-1746 (2015-10-17)
Withaferin A (WA), a natural product derived from Withania somnifera, has been used in traditional oriental medicines to treat neurological disorders. Recent studies have demonstrated that this compound may have a potential for cancer treatment and a clinical trial has
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.