콘텐츠로 건너뛰기
Merck
모든 사진(1)

문서

EHU091841

Sigma-Aldrich

MISSION® esiRNA

targeting human INSR

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

AAGTGCATCCCTGAGTGTCCCTCCGGGTACACGATGAATTCCAGCAACTTGCTGTGCACCCCATGCCTGGGTCCCTGTCCCAAGGTGTGCCACCTCCTAGAAGGCGAGAAGACCATCGACTCGGTGACGTCTGCCCAGGAGCTCCGAGGATGCACCGTCATCAACGGGAGTCTGATCATCAACATTCGAGGAGGCAACAATCTGGCAGCTGAGCTAGAAGCCAACCTCGGCCTCATTGAAGAAATTTCAGGGTATCTAAAAATCCGCCGATCCTACGCTCTGGTGTCACTTTCCTTCTTCCGGAAGTTACGTCTGATTCGAGGAGAGACCTTGGAAATTGGGAACTACTCCTTCTATGCCTTGGACAACCAGAACCTAAGGCAGCTCTGGGACTGGAGCAAACACAACCTCACCATCACTCAGGG

Ensembl | 인체 수납 번호

ENSG00000171105

NCBI 수납 번호

NM_000208

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... INSR(3643) , INSR(3643)

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Phoebe L Sarkar et al.
Frontiers in endocrinology, 10, 481-481 (2019-08-06)
Androgen deprivation therapy (ADT) is the standard treatment for advanced prostate cancer (PCa), yet many patients relapse with lethal metastatic disease. With this loss of androgens, increased cell plasticity has been observed as an adaptive response to ADT. This includes
Zheqi Li et al.
Endocrinology, 159(1), 285-296 (2017-10-14)
Increased evidence suggests that somatic mutations in the ligand-binding domain of estrogen receptor [ER (ERα/ESR1)] are critical mediators of endocrine-resistant breast cancer progression. Insulinlike growth factor-1 (IGF1) is an essential regulator of breast development and tumorigenesis and also has a
Oscar Escribano et al.
Molecular and cellular endocrinology, 409, 82-91 (2015-03-24)
The main compensatory response to insulin resistance is the pancreatic beta cell hyperplasia to account for increased insulin secretion. In fact, in a previous work we proposed a liver-pancreas endocrine axis with IGF-I (insulin-like growth factor type I) secreted by
Masafumi Aoki et al.
PloS one, 14(10), e0223528-e0223528 (2019-10-04)
The aim of this study was to identify changes in skin function associated with obesity and the mechanisms underlying these changes. Functional changes and gene expression in skin were investigated in C57BL/6J mice fed either a control or high-fat diet
Sandip Mukherjee et al.
PloS one, 12(1), e0169809-e0169809 (2017-01-11)
Dramatic increase of diabetes over the globe is in tandem with the increase in insulin requirement. This is because destruction and dysfunction of pancreatic β-cells are of common occurrence in both Type1 diabetes and Type2 diabetes, and insulin injection becomes
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.