설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
TGCATTCCTGCTGTTTCAAGATGAAAGCTCTGTGCAGGCTCTCATTGATGCATGCATTGAAGAAGATGGAAAACTCTACCTTTGTGTATCAAGTCCCACTATCAAGGATAAGCCAGTCCAGATTCGGCCTTGGAATCTCAGTGACAGTGACTTTGTGATGGATGGTTCACAGCCACTTGACCCACGAAAAACTATATTTGTTGGTGGTGTTCCTCGACCATTACGAGCTGTGGAGCTTGCGATGATAATGGATCGGCTATATGGAGGTGTGTGCTACGCTGGGATTGATACCGACCCTGAGCTAAAATACCCAAAAGGAGCTGGGAGAGTTGCGTTCTCTAATCAACAGAGTTACATAGCTGCTATCAGTGCCCGCTTTGTTCAGCTGCAGCATGGAGAGATAGATAAACGGGTGGAAGTTAAGCC
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... CPEB4(80315) , CPEB4(80315)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Valeria Giangarrà et al.
PloS one, 10(9), e0138794-e0138794 (2015-09-24)
CPEB (Cytoplasmic Polyadenylation Element Binding) proteins are a family of four RNA-binding proteins that regulate the translation of maternal mRNAs controlling meiotic cell cycle progression. But CPEBs are not limited to the transcriptionally silent germline; they are also expressed, in
Weihua Huang et al.
Diagnostic pathology, 10, 127-127 (2015-07-26)
The microRNAs present a class of non-coding RNAs which are usually implicated in tumor biology. Recent report has unraveled that a novel member of microRNA family called miR-1246. However, the functional role and molecular mechanisms of miR-1246 in non-small cell
Eva Pérez-Guijarro et al.
Nature communications, 7, 13418-13418 (2016-11-20)
Nuclear 3'-end-polyadenylation is essential for the transport, stability and translation of virtually all eukaryotic mRNAs. Poly(A) tail extension can also occur in the cytoplasm, but the transcripts involved are incompletely understood, particularly in cancer. Here we identify a lineage-specific requirement
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.