설명
Powered by Eupheria Biotech
제품 라인
MISSION®
형태
lyophilized powder
esiRNA cDNA 표적 서열
TCCTCTGTAAAAAGATCCCTGAGATTATTCCTTCTTCTAGTTTTATGCGACAGCTTTACTTTAAAATTCAAGTTATACATCTTGGGAGTACAATGGCCCGACATTTCTTCATAGGTAGAAACAAATACTTGACTCAGTGATACTCATGACCATTAGAATAGTCATACCTGGAATGTGTCAAATTATAAGAGACAGACACTTGGTTAGTGGCTGCCTCATATAGCACTTTTGAAGAGGCCTAAGTCAAAACTTGCAATATAACATTCTATTGACTTTCTTAAAAATATTTTTTCTGTACCTAACTTGAGCATAAGGGTTATTTGAGCAAGTAACATTAACTCAGTGGAAGGCATTGTCCTGTGAAATATTCTTAGGCAGATCTGCCCACATCTTTATTGAA
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... MRE11(4361) , MRE11A(4361)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
생화학적/생리학적 작용
MRE11A (meiotic recombination 11 homolog A) is a nuclease which forms complex with Rad50 (DNA repair protein) and Nbs1 (nijmegen breakage syndrome protein 1). This complex works as a sensor of DNA double strand breaks, and is involved in DNA repair processes and DNA damage response. Absence of the complex activity causes developmental and/or degenerative neuronal disorders. In homologous recombination repair, MRE11A is responsible for the 3′-to-5′ exonuclease activity, leading to the generation of protruding 3′ ssDNA at double strand breaks. MRE11A is also an oncoprotein which is associated with colorectal cancer and malignant breast cancer. Hypomorphic mutations in this gene leads to Ataxia-Telangiectasia like disorder.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
시험 성적서(COA)
제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.
Interaction of MRE11 and Clinicopathologic Characteristics in Recurrence of Breast Cancer: Individual and Cumulated Receiver Operating Characteristic Analyses.
Yang CH
BioMed Research International, 2017, 2563910-2563910 (2017)
Rad51 recombinase prevents Mre11 nuclease-dependent degradation and excessive PrimPol-mediated elongation of nascent DNA after UV irradiation.
Vallerga MB
Proceedings of the National Academy of Sciences of the USA, 112, E6624-E6624 (2015)
M Petroni et al.
Cell death and differentiation, 23(2), 197-206 (2015-06-13)
The MRE11/RAD50/NBS1 (MRN) complex is a major sensor of DNA double strand breaks, whose role in controlling faithful DNA replication and preventing replication stress is also emerging. Inactivation of the MRN complex invariably leads to developmental and/or degenerative neuronal defects
A Bakr et al.
Nucleic acids research, 43(6), 3154-3166 (2015-03-11)
Ataxia-telangiectasia mutated (ATM) is needed for the initiation of the double-strand break (DSB) repair by homologous recombination (HR). ATM triggers DSB end resection by stimulating the nucleolytic activity of CtIP and MRE11 to generate 3'-ssDNA overhangs, followed by RPA loading
Ying Wai Chan et al.
Nature cell biology, 20(1), 92-103 (2017-12-20)
The resolution of joint molecules that link recombining sister chromatids is essential for chromosome segregation. Here, we determine the fate of unresolved recombination intermediates arising in cells lacking two nucleases required for resolution (GEN1 -/- knockout cells depleted of MUS81).
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.