콘텐츠로 건너뛰기
Merck
모든 사진(1)

Key Documents

EHU090781

Sigma-Aldrich

MISSION® esiRNA

targeting human MECOM (1)

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

TGCATAGATGCCAGTCAACCAGATGTTGGAAGCTGGCTCAAGTACATTAGATTCGCTGGCTGTTATGATCAGCACAACCTTGTTGCATGCCAGATAAATGATCAGATATTCTATAGAGTAGTTGCAGACATTGCGCCGGGAGAGGAGCTTCTGCTGTTCATGAAGAGCGAAGACTATCCCCATGAAACTATGGCGCCGGATATCCACGAAGAACGGCAATATCGCTGCGAAGACTGTGACCAGCTCTTTGAATCTAAGGCTGAACTAGCAGATCACCAAAAGTTTCCATGCAGTACTCCTCACTCAGCATTTTCAATGGTTGAAGAGGACTTTCAGCAAAAACTCGAAAGCGAGAATGATCTCCAAGAGATACACACGATCCAGGAGTGTAAGGAATGTGACCAAGTTTTTCCTGATTTGCAAAGCC

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

F Mateo et al.
Oncogene, 36(19), 2737-2749 (2016-12-20)
Inhibitors of the mechanistic target of rapamycin (mTOR) are currently used to treat advanced metastatic breast cancer. However, whether an aggressive phenotype is sustained through adaptation or resistance to mTOR inhibition remains unknown. Here, complementary studies in human tumors, cancer
Gerwin Heller et al.
Journal of hematology & oncology, 8, 28-28 (2015-04-18)
The transcription factor Ecotropic Virus Integration site 1 (EVI1) regulates cellular proliferation, differentiation, and apoptosis, and its overexpression contributes to an aggressive course of disease in myeloid leukemias and other malignancies. Notwithstanding, knowledge about the target genes mediating its biological
Lai-Sheung Chan et al.
International journal of molecular sciences, 21(15) (2020-08-06)
The Wnt signaling pathway is one of the major signaling pathways used by cancer stem cells (CSC). Ecotropic Viral Integration Site 1 (EVI1) has recently been shown to regulate oncogenic development of tumor cells by interacting with multiple signaling pathways
Anjan Kumar Pradhan et al.
PloS one, 6(9), e25370-e25370 (2011-10-08)
EVI1 (Ecotropic Viral Integration site I), which was originally identified as a myeloid transforming gene by means of retroviral insertional mutagenesis in mouse leukemia, encodes a nuclear DNA binding zinc finger protein. The presence of zinc fingers that are able

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.