콘텐츠로 건너뛰기
Merck
모든 사진(1)

Key Documents

EHU090761

Sigma-Aldrich

MISSION® esiRNA

targeting human CASP7

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

GGTGTTTCAACAGAGGGAGTTTAATACAGGAAATTGACTTACATAGATGATAAAAGAGAAGCCAAACAGCAAGAAGCTGTTACCACACCCAGGGCTATGAGGATAATGGGAAGAGGTTTGGTTTCCTGTGTCCAGTAGTGGGATCATCCAGAGGAGCTGGAACCATGGTGGGGGCTGCCTAGTGGGAGTTAGGACCACCAATGGATTGTGGAAAATGGAGCCATGACAAGAACAAAGCCACTGACTGAGATGGAGTGAGCTGAGACAGATAAGAGAATACCTTGGTCTCACCTATCCTGCCCTCACATCTTCCACCAGCACCTTACTGCCCAGGCCTATCTGGAAGCCACCTCACCAAGGACCTTGGAAGAGCAAGGGACAGTGAGGCAGGAGAAGAACAAGAAATGGATGTAAGCCTGGCCCATAA

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

관련 카테고리

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Ri Cui et al.
Oncotarget, 6(26), 21802-21815 (2015-08-27)
We recently reported that miR-224 was significantly up-regulated in non-small cell lung cancer (NSCLC) tissues, in particular in resected NSCLC metastasis. We further demonstrated that miR-224 functions as an oncogene in NSCLC by directly targeting TNFAIP1 and SMAD4. However, the
Woo Jin Jeong et al.
PloS one, 7(9), e45754-e45754 (2012-10-11)
In addition to its well-characterized role in the lens, αB-crystallin performs other functions. Methylglyoxal (MGO) can alter the function of the basement membrane of retinal pigment epithelial (RPE) cells. Thus, if MGO is not efficiently detoxified, it can induce adverse
Xiujin Shen et al.
Cell death & disease, 12(2), 186-186 (2021-02-17)
Chemotherapy drug-induced nephrotoxicity limits clinical applications for treating cancers. Pyroptosis, a newly discovered programmed cell death, was recently reported to be associated with kidney diseases. However, the role of pyroptosis in chemotherapeutic drug-induced nephrotoxicity has not been fully clarified. Herein

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.