콘텐츠로 건너뛰기
Merck
모든 사진(1)

문서

EHU089381

Sigma-Aldrich

MISSION® esiRNA

targeting human NEDD9

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

GAGAGGAGCTGGATGGATGACTACGATTACGTCCACCTACAGGGTAAGGAGGAGTTTGAGAGGCAACAGAAAGAGCTATTGGAAAAAGAGAATATCATGAAACAGAACAAGATGCAGCTGGAACATCATCAGCTGAGCCAGTTCCAGCTGTTGGAACAAGAGATTACAAAGCCCGTGGAGAATGACATCTCGAAGTGGAAGCCCTCTCAGAGCCTACCCACCACAAACAGTGGCGTGAGTGCTCAGGATCGGCAGTTGCTGTGCTTCTACTATGACCAATGTGAGACCCATTTCATTTCCCTTCTCAACGCCATTGACGCACTCTTCAGTTGTGTCAGCTCAGCCCAGCCCCCGCGAATCTTCGTGGCACACAGCAAGTTTGTCATCCTCAGTGCACACA

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Zhiling Tang
Journal of B.U.ON. : official journal of the Balkan Union of Oncology, 23(3), 782-786 (2018-07-14)
To investigate the effects of human enhancer of filamentation 1 (HEF1) gene on the proliferation, invasion and metastasis of bladder cancer cells. Three human bladder cancer cell lines (T24, EJ and BIU-87) were selected to extract total RNA at logarithmic
Nosheen Akhtar et al.
Molecular carcinogenesis, 57(5), 653-663 (2018-02-14)
Epithelial-to-mesenchymal transition (EMT) plays a crucial role in prostate cancer (PCa) metastasis. This has led to a surge in the efforts for identification of safer and more effective compounds which can modulate EMT and consequently inhibiting migration and invasion of
Yaoping Liu et al.
Genome research, 25(5), 679-689 (2015-04-11)
Candida albicans, the major invasive fungal pathogen of humans, can cause both debilitating mucosal infections and fatal invasive infections. Understanding the complex nature of the host-pathogen interaction in each of these contexts is essential to developing desperately needed therapies to
Peng Lu et al.
Oncology reports, 33(5), 2375-2383 (2015-03-31)
Neural precursor cell expressed, developmentally downregulated 9 (NEDD9) plays an integral role in natural and pathological cell biology. Overexpression of NEDD9 protein has been correlated with poor prognosis in various types of cancer. However, few available data address the precise

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.