설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
AGTGGGCAAGGCAAAGTCTATAATCTGATCAACCGGAGGCGATTTCAGCAGATGGATGTGCTAGAGGGACTGAATGTCCTTGTGACAATTTCAGGAAAGAAGAATAAGCTACGAGTTTACTATCTTTCATGGTTAAGAAACAGAATACTACATAATGACCCAGAAGTAGAAAAGAAACAAGGCTGGATCACTGTTGGGGACTTGGAAGGCTGTATACATTATAAAGTTGTTAAATATGAAAGGATCAAATTTTTGGTGATTGCCTTAAAGAATGCTGTGGAAATATATGCTTGGGCTCCTAAACCGTATCATAAATTCATGGCATTTAAGTCTTTTGCAGATCTCCAGCACAAGCCTCTGCTAGTTGATCTCACGGTAGAAGAAGGTCAAAGATTAAAGGTTATTTTTGGTTCACACACTGGTTTCCA
Ensembl | 인체 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... TNIK(23043) , TNIK(23043)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Kyeong-Yong Park et al.
PloS one, 15(8), e0232917-e0232917 (2020-08-19)
In human lung cancer progression, the EMT process is characterized by the transformation of cancer cells into invasive forms that migrate to other organs. Targeting to EMT-related molecules is emerging as a novel therapeutic approach for the prevention of lung
Martin Larhammar et al.
The Journal of neuroscience : the official journal of the Society for Neuroscience, 37(46), 11074-11084 (2017-10-11)
The c-Jun-N-terminal kinase (JNK) signaling pathway regulates nervous system development, axon regeneration, and neuronal degeneration after acute injury or in chronic neurodegenerative disease. Dual leucine zipper kinase (DLK) is required for stress-induced JNK signaling in neurons, yet the factors that
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.