콘텐츠로 건너뛰기
Merck
모든 사진(1)

문서

EHU085701

Sigma-Aldrich

MISSION® esiRNA

targeting human APP

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

CTCGTTCCTGACAAGTGCAAATTCTTACACCAGGAGAGGATGGATGTTTGCGAAACTCATCTTCACTGGCACACCGTCGCCAAAGAGACATGCAGTGAGAAGAGTACCAACTTGCATGACTACGGCATGTTGCTGCCCTGCGGAATTGACAAGTTCCGAGGGGTAGAGTTTGTGTGTTGCCCACTGGCTGAAGAAAGTGACAATGTGGATTCTGCTGATGCGGAGGAGGATGACTCGGATGTCTGGTGGGGCGGAGCAGACACAGACTATGCAGATGGGAGTGAAGACAAAGTAGTAGAAGTAGCAGAGGAGGAAGAAGTGGCTGAGGTGGAAGAAGAAGAAGCCGATGATGACGAGGACGATGAGGATGGTGATGAGGTAGAGGAAGAGGCTGAGGAACCCTACGAAGAAGCCACAGAGAGAACCACCAGCA

Ensembl | 인체 수납 번호

ENSG00000142192

NCBI 수납 번호

NM_201414

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... APP(351) , APP(351)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Bruce X Wong et al.
PloS one, 9(12), e114174-e114174 (2014-12-03)
Ceruloplasmin is a ferroxidase that interacts with ferroportin to export cellular iron, but is not expressed in neurons. We recently reported that the amyloid precursor protein (APP) is the analogous iron-exporting chaperone for neurons and other cells. The ferroxidase activity
Changyi Ji et al.
Cellular and molecular neurobiology, 38(4), 941-954 (2017-11-28)
Iron efflux in mammalian cells is mediated by the ferrous iron exporter ferroportin (Fpn); Fpn plasma membrane localization and function are supported by a multicopper ferroxidase and/or the soluble amyloid precursor protein (sAPP). Fpn and APP are ubiquitously expressed in
Nathalie Pierrot et al.
EMBO molecular medicine, 5(4), 608-625 (2013-04-05)
Perturbation of lipid metabolism favours progression of Alzheimer disease, in which processing of Amyloid Precursor Protein (APP) has important implications. APP cleavage is tightly regulated by cholesterol and APP fragments regulate lipid homeostasis. Here, we investigated whether up or down
Philipp Spitzer et al.
Frontiers in immunology, 11, 1967-1967 (2020-10-06)
It has been previously shown that the amyloid precursor protein (APP) support the innate immune defense as an immune receptor. Amyloid β (Aβ) peptides seem to have properties of an antimicrobial peptide and can act as opsonines. In APP-deficient mouse
Livius V d'Uscio et al.
Journal of cerebral blood flow and metabolism : official journal of the International Society of Cerebral Blood Flow and Metabolism, 38(10), 1715-1726 (2017-09-30)
The exact physiological function of amyloid-β precursor protein (APP) in endothelial cells is unknown. Endothelium-specific APP-deficient (eAPP-/-) mice were created to gain new insights into the role of APP in the control of vascular endothelial function. Endothelium-dependent relaxations to acetylcholine
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.