콘텐츠로 건너뛰기
Merck
모든 사진(1)

문서

EHU085631

Sigma-Aldrich

MISSION® esiRNA

targeting human GNL3

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

AAGCCATCAAATGTGGAACCTATGGAAAAGGAGTTTGGGCTTTGCAAAACTGAGAACAAAGCCAAGTCGGGCAAACAGAATTCAAAGAAGCTGTACTGCCAAGAACTTAAAAAGGTGATTGAAGCCTCCGATGTTGTCCTAGAGGTGTTGGATGCCAGAGATCCTCTTGGTTGCAGATGTCCTCAGGTAGAAGAGGCCATTGTCCAGAGTGGACAGAAAAAGCTGGTACTTATATTAAATAAATCAGATCTGGTACCAAAGGAGAATTTGGAGAGCTGGCTAAATTATTTGAAGAAAGAATTGCCAACAGTGGTGTTCAGAGCCTCAACAAAACCAAAGGATAAAGGGAAGATAACCAAGCGTGTGAAGGCAAAGAAGAATGCTGCTCCATTCAGAAGTGAAGTCTGCTTTGGGAAAGAGGGCCTTTGGAAAC

Ensembl | 인체 수납 번호

ENSG00000163938

NCBI 수납 번호

NM_014366

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... GNL3(26354) , GNL3(26354)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Mei-Hong Li et al.
Journal of pediatric surgery, 49(8), 1286-1291 (2014-08-06)
Neuroblastoma (NB) is the most common extracranial solid tumor of childhood. Preliminary data derived from a human angiogenesis array in NB showed that the bioactive lipid sphingosine-1-phosphate (S1P) induced the secretion of several angiogenesis-related proteins including the important inflammatory factor
Tengwei Cao et al.
PloS one, 9(8), e103793-e103793 (2014-08-08)
Atrial hypertrophy and fibrosis are essential pathological features of atrial fibrillation. Recently, adiponectin has become a protein of interest due to its beneficial effects on cardiovascular diseases. However, the molecular mechanism of atrial structural remodeling and signaling pathways evoked by
Zhihong Yuan et al.
PloS one, 9(5), e94241-e94241 (2014-05-21)
It is increasingly recognized that the tumor microenvironment plays a critical role in the initiation and progression of lung cancer. In particular interaction of cancer cells, macrophages, and inflammatory response in the tumor microenvironment has been shown to facilitate cancer
Junyue Xing et al.
Molecular and cellular biology, 35(23), 4043-4052 (2015-09-24)
The tRNA methytransferase NSun2 promotes cell proliferation, but the molecular mechanism has not been elucidated. Here, we report that NSun2 regulates cyclin-dependent kinase 1 (CDK1) expression in a cell cycle-dependent manner. Knockdown of NSun2 decreased the CDK1 protein level, while

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.