설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
CAAAGACAACGCCTCTGACAAGGACCTGGCCGACCTGGTCTCGGAGATGGAGGTGATGAAGCTGATCGGCCGACACAAGAACATCATCAACCTGCTTGGTGTCTGCACCCAGGAAGGGCCCCTGTACGTGATCGTGGAGTGCGCCGCCAAGGGAAACCTGCGGGAGTTCCTGCGGGCCCGGCGCCCCCCAGGCCCCGACCTCAGCCCCGACGGTCCTCGGAGCAGTGAGGGGCCGCTCTCCTTCCCAGTCCTGGTCTCCTGCGCCTACCAGGTGGCCCGAGGCATGCAGTATCTGGAGTCCCGGAAGTGTATCCACCGGGACCTGGCTGCCCGCAATGTGCTGGTGACTGAGGACAATGTGATGAAGATTGCTGACTTTGGGCTGGCCCGCGGCGTCCACCACATTGACTACTATAAGAAAACCAGCAACGGC
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... FGFR4(2264) , FGFR4(2264)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Qiuchen Cai et al.
Life sciences, 248, 117465-117465 (2020-02-28)
Severe peripheral nerve injury leads to skeletal muscle atrophy and impaired limb function that is not sufficiently improved by existing treatments. Fibroblast growth factor 6 (FGF6) is involved in tissue regeneration and is dysregulated in denervated rat muscles. However, the
Susagna Padrissa-Altés et al.
Gut, 64(9), 1444-1453 (2014-11-25)
Fibroblast growth factors (Fgfs) are key orchestrators of development, and a role of Fgfs in tissue repair is emerging. Here we studied the consequences of inducible loss of Fgf receptor (Fgfr) 4, the major Fgf receptor (Fgfr) on hepatocytes, alone
Huan Lin et al.
Frontiers in pharmacology, 10, 1515-1515 (2020-01-11)
Endocrine fibroblast growth factor (FGF) 19 has been shown to be capable of maintaining bile acid (BA) homeostasis and thus hold promise to be a potential therapeutic agent for cholestasis liver disease. However, whether paracrine FGFs possess this BA regulatory
Jing Yang et al.
Cell cycle (Georgetown, Tex.), 14(20), 3318-3330 (2015-09-18)
Fibroblast growth factors (FGF1, FGF2 and FGF4) and fibroblast growth factor receptors (FGFR1, FGFR2, FGFR3 and FGFR4) have been reported to be expressed in preimplantation embryos and be required for their development. However, the functions of these molecules in trophectoderm
Shuxin Han et al.
Nature communications, 6, 7231-7231 (2015-06-05)
Circadian control of nutrient availability is critical to efficiently meet the energetic demands of an organism. Production of bile acids (BAs), which facilitate digestion and absorption of nutrients, is a major regulator of this process. Here we identify a KLF15-Fgf15
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.