콘텐츠로 건너뛰기
Merck
모든 사진(1)

Key Documents

EHU085401

Sigma-Aldrich

MISSION® esiRNA

targeting human GATA4

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

AGCTCCTTCAGGCAGTGAGAGCCTTCCTCCCGCCAGCGGTGCTTCCAGCAACTCCAGCAACGCCACCACCAGCAGCAGCGAGGAGATGCGTCCCATCAAGACGGAGCCTGGCCTGTCATCTCACTACGGGCACAGCAGCTCCGTGTCCCAGACGTTCTCAGTCAGTGCGATGTCTGGCCATGGGCCCTCCATCCACCCTGTCCTCTCGGCCCTGAAGCTCTCCCCACAAGGCTATGCGTCTCCCGTCAGCCAGTCTCCACAGACCAGCTCCAAGCAGGACTCTTGGAACAGCCTGGTCTTGGCCGACAGTCACGGGGACATAATCACTGCGTAATCTTCCCTCTTCCCTCCTCAAATTCCTGCACGGACCTGGGACTTGGAGGATAGCAAAGAAGGAGGCC

Ensembl | 인체 수납 번호

ENSG00000136574

NCBI 수납 번호

NM_002052

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... GATA4(2626) , GATA4(2626)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Yihua Pei et al.
Oncotarget, 7(47), 77890-77901 (2016-10-28)
GATA4 is a zinc finger DNA-binding protein that plays an important role in mammalian liver development. However, the effects of GATA4 in hepatoblastoma (HB), a common liver cancer in pediatric patients, remain largely unknown. In this study, we demonstrate that
Xuren Gao et al.
Molecular and cellular endocrinology, 506, 110759-110759 (2020-02-18)
To investigate the role of miR-411-5p and miR-434-3p in osteoblast differentiation in particulate-induced osteolysis. A mouse model of osteolysis and an in vitro osteolysis model were constructed. The expressions of molecules were detected using qRT-PCR and western blot. Alkaline phosphatase
Jie Xiao et al.
Neuroreport, 29(9), 723-730 (2018-04-07)
MicroRNAs (miRNAs) have been documented as critical regulators in ischemia/reperfusion-induced neuronal death. A better understanding of miRNA-mediated molecular mechanisms in ischemia/reperfusion-induced neuronal death may provide therapeutic targets for cerebral ischemia/reperfusion injury. A growing body of evidence suggests that miR-429 is
Li Jin et al.
Scientific reports, 7(1), 15607-15607 (2017-11-17)
Gallic acid (GA) has been reported to have beneficial effects on cancer, vascular calcification, and diabetes-induced myocardial dysfunction. We hypothesized that GA controls hypertension via oxidative stress response regulation in an animal model for essential hypertension. Spontaneously hypertensive rats (SHRs)
Caterina Negroni et al.
EBioMedicine, 59, 102941-102941 (2020-08-19)
Meningiomas are the most common primary intracranial tumours. They are classified as grade I, II, and III based on their histopathological features. While most meningiomas can be managed by surgery alone, adjuvant treatment may be required in case of recurrent

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.