설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
형태
lyophilized powder
esiRNA cDNA 표적 서열
TTTTGTTGAATGCGCAAGAGGGCTGGTCTGCGCAGGAGAAATGGACTCTGGAGCGCCTAAAAAGGAAATATCGGAACCAGAAGTTCAAGTGTGGTGAGGATAACGATGGCTACTCAGTGAAGATGAAGATGAAATACTACATCGAGTACATGGAGAGCACTCGAGATGATAGTCCCCTTTACATCTTTGACAGCAGCTATGGTGAACACCCTAAAAGAAGGAAACTTTTGGAAGACTACAAGGTGCCAAAGTTTTTCACTGATGACCTTTTCCAGTATGCTGGGGAGAAGCGCAGGCCCCCTTACAGGTGGTTTGTGATGGGGCCACCACGCTCCGGAACTGGGATTCACATCGACCCTCTGGGAACCAGTGCCTGGAATGCCTTAGTTCAGGGCCACAAGC
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... JMJD6(23210) , JMJD6(23210)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
시험 성적서(COA)
제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.
Carcinogenesis, 37(2), 119-128 (2015-12-10)
Cancer stem cells (CSCs) are defined as a small subpopulation of cancer cells within a tumor and responsible for initiation and maintenance of tumor growth. Thus, understanding of molecular regulators of CSCs is of paramount importance for the development of
Oncogene, 38(7), 980-997 (2018-09-07)
Overexpression of Jumonji domain-containing 6 (JMJD6) has been reported to be associated with more aggressive breast cancer characteristics. However, the precise role of JMJD6 in breast cancer development remains unclear. Here, we demonstrate that JMJD6 has intrinsic tyrosine kinase activity
Cancer research, 81(4), 1087-1100 (2021-04-07)
Endocrine resistance (EnR) in advanced prostate cancer is fatal. EnR can be mediated by androgen receptor (AR) splice variants, with AR splice variant 7 (AR-V7) arguably the most clinically important variant. In this study, we determined proteins key to generating
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.