설명
Powered by Eupheria Biotech
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
TGGCATTTATGACCCTTGTGAAAAAGAAGCCACTGATGCTATTGGGCATCTAGACAGACAGCAACGGGAAGATATCACACAGAGTGCGCAGCACGCACTGCGGCTCGCTGCCTTCGGCCAGCTCCATAAAGTCCTAGGCATGGACCCTCTGCCTTCCAAGATGCCCAAGAAACCAAAGAATGAAAACCCAGTGGACTACACCGTTCAGATCCCACCAAGCACCACCTATGCCATTACGCCCATGAAACGCCCAATGGAGGAGGACGGGGAGGAGAAGTCGCCCAGCAAAAAGAAGAAGAAGATTCAGAAGAAAGAGGAGAAGGCAGAGCCCCCCCAGGCTATGAATGCCCTGATGCGGTTGAACCAGCTGAAGCCAGGGCTGCAGTACAAGCTGGTGTCCCA
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... ILF3(3609) , ILF3(3609)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
M Laura Idda et al.
Nucleic acids research, 46(22), 12040-12051 (2018-10-03)
Polymorphisms in untranslated regions (UTRs) of disease-associated mRNAs can alter protein production. We recently identified a genetic variant in the 3'UTR of the TNFSF13B gene, encoding the cytokine BAFF (B-cell-activating factor), that generates an alternative polyadenylation site yielding a shorter
Tracey W Chan et al.
Genome biology, 21(1), 268-268 (2020-10-28)
RNA editing generates modifications to the RNA sequences, thereby increasing protein diversity and shaping various layers of gene regulation. Recent studies have revealed global shifts in editing levels across many cancer types, as well as a few specific mechanisms implicating
Rong Jia et al.
RNA (New York, N.Y.), 25(5), 630-644 (2019-02-24)
Alternative RNA splicing is an important focus in molecular and clinical oncology. We report here that SRSF3 regulates alternative RNA splicing of interleukin enhancer binding factor 3 (ILF3) and production of this double-strand RNA-binding protein. An increased coexpression of ILF3
Zejin Pu et al.
Journal of cellular biochemistry, 120(10), 18172-18185 (2019-05-31)
Adenosine is a promising cytotoxic reagent for tumors, long noncoding RNA (lncRNA) maternally expressed gene 3 (MEG3) has been indicated to play critical roles in tumorigenesis, ILF3 has been recognized as a MEG3-binding protein, however, the roles of adenosine and
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.