추천 제품
설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
TGTGTCCAGGTGACCAAAGATGTGACCAAGGCCATGGATGAGAAGAAATTTGACGAAGCCCTGAAGCTGAGAGGCCGGAGCTTCATGAACAACTGGGAGGTGTACAAGCTTCTAGCTCATGTCAGACCCCCGGTATCTAAGAGTGGTTCGCACACAGTGGCTGTGATGAACGTGGGGGCTCCGGCTGCAGGCATGAATGCTGCTGTTCGCTCCACTGTGAGGATTGGCCTTATCCAGGGCAACCGAGTGCTCGTTGTCCATGATGGTTTCGAGGGCCTGGCCAAGGGGCAGATAGAGGAAGCTGGCTGGAGCTATGTTGGGGGCTGGACTGGCCAAGGTGGCTCTAAACTTGGGACTAAAAGGACTCTACCCAAGAAGAGCTTTGAACAGATCAGTGCCAATATAACTAAGTTTAACATTCAGGGCCTTGTCATC
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... PFKM(5213) , PFKM(5213)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Rui-Fang Tian et al.
American journal of translational research, 12(9), 4923-4940 (2020-10-13)
This study explored the effects of phosphofructokinase-1 (PFK1) on the radiosensitivity of colorectal cancer (CRC) in vivo and in vitro and the underlying mechanisms. Tissue samples from 48 patients with rectal cancer who had received neoadjuvant radiotherapy followed by surgery
Jinling Cui et al.
Journal of agricultural and food chemistry, 67(38), 10637-10645 (2019-09-13)
Previous studies have shown that selenite, a representative of inorganic form selenium, exerts its anticancer effect by inducing apoptosis in androgen-dependent LNCaP prostate cancer cells, but few studies have determined the nature of cell death induced by selenite in metastatic
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.