설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
CCCAGAACCTCTGGAGACTGGAAATTGTGAACAGAGGATCTGACACAGACGTCTGGAAGACCATCCTCTCAGAGGTCCGCTTTGTGCACGTGAACACTTCCGCTGTCTTAAAGCTGAGCGGGGCTCACCTCCCTGACTGGGGGTATCGGCAACTGGAGATCGTCGGGGAGAAGCTGTCCCGGGGCTACCACGGGAGCACGGTGTGGAACGTGGAGGAGCACCGATACGGCGCGAGCCAGGAGCAGAGGGAGCGGGAACGGGAGCTGCACTCACCTGCGCAGGTGGACGTCAGCAGGAACCTCAGCTTCATGGCGAGATTCTCGGAGCTGCAGTGGAGGATGCTGGCGCTGAGAAGTGATGACTCGGAACACAAGTACAGCTCCAGCCCACTGGAGTGGGTCACCCTGGACACCAATATTGCCTACTGGCTGCACC
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... POMT1(10585) , POMT1(10585)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Gene-Errol E Ringpis et al.
PloS one, 7(12), e53492-e53492 (2013-01-10)
Down-regulation of the HIV-1 coreceptor CCR5 holds significant potential for long-term protection against HIV-1 in patients. Using the humanized bone marrow/liver/thymus (hu-BLT) mouse model which allows investigation of human hematopoietic stem/progenitor cell (HSPC) transplant and immune system reconstitution as well
SMaRT lncRNA controls translation of a G-quadruplex-containing mRNA antagonizing the DHX36 helicase.
Julie Martone et al.
EMBO reports, 21(6), e49942-e49942 (2020-04-28)
Guanine-quadruplexes (G4) included in RNA molecules exert several functions in controlling gene expression at post-transcriptional level; however, the molecular mechanisms of G4-mediated regulation are still poorly understood. Here, we describe a regulatory circuitry operating in the early phases of murine
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.