콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU079451

Sigma-Aldrich

MISSION® esiRNA

targeting human GSK3B

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

CTGGTCGCCATCAAGAAAGTATTGCAGGACAAGAGATTTAAGAATCGAGAGCTCCAGATCATGAGAAAGCTAGATCACTGTAACATAGTCCGATTGCGTTATTTCTTCTACTCCAGTGGTGAGAAGAAAGATGAGGTCTATCTTAATCTGGTGCTGGACTATGTTCCGGAAACAGTATACAGAGTTGCCAGACACTATAGTCGAGCCAAACAGACGCTCCCTGTGATTTATGTCAAGTTGTATATGTATCAGCTGTTCCGAAGTTTAGCCTATATCCATTCCTTTGGAATCTGCCATCGGGATATTAAACCGCAGAACCTCTTGTTGGATCCTGATACTGCTGTATTAAAACTCTGTGACTTTGGAAGTGCAAAGCAGCTGGTCCGAGGAGAACCCAATGTTTCG

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Baocheng Hu et al.
The Journal of biological chemistry, 292(8), 3531-3540 (2017-01-18)
miR-21, as an oncogene that overexpresses in most human tumors, is involved in radioresistance; however, the mechanism remains unclear. Here, we demonstrate that miR-21-mediated radioresistance occurs through promoting repair of DNA double strand breaks, which includes facilitating both non-homologous end-joining
Benjamin Stump et al.
PloS one, 14(4), e0213831-e0213831 (2019-04-10)
Lymphatic vessels play an important role in health and in disease. In this study, we evaluated the effects of GSK3-β inhibition on lung lymphatic endothelial cells in vitro. Pharmacological inhibition and silencing of GSK3-β resulted in increased lymphangiogenesis of lung
Linna Liu et al.
Oncology reports, 32(4), 1395-1400 (2014-08-12)
Rac1 has been shown to regulate the cell cycle in cancer cells. Yet, the related mechanism remains unclear. Thus, the present study aimed to investigate the mechanism involved in the regulation of G1/S phase transition by Rac1 in cancer cells.
Javier Duran et al.
PloS one, 11(12), e0168255-e0168255 (2016-12-16)
Testosterone induces cardiac hypertrophy through a mechanism that involves a concerted crosstalk between cytosolic and nuclear signaling pathways. Nuclear factor of activated T-cells (NFAT) is associated with the promotion of cardiac hypertrophy, glycogen synthase kinase-3β (GSK-3β) is considered to function
M S Rashid et al.
Scientific reports, 8(1), 14259-14259 (2018-09-27)
The mitotic checkpoint ensures proper chromosome segregation; defects in this checkpoint can lead to aneuploidy, a hallmark of cancer. The mitotic checkpoint blocks progression through mitosis as long as chromosomes remain unattached to spindle microtubules. Unattached kinetochores induce the formation

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.