설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
CTCCCTTCTGTCCTCAGCAAGGCTCGGTCCTGGACATTCTAGGTCCCTGACTCGCCAGATGCATCATGTCCATTTTGGGAAAATGGACTGAAGTTTCTGGAGCCCTTGTCTGAGACTGAACCTCCTGAGAAGGGGCCCCTAGCAGCGGTCAGAGGTCCTGTCTGGATGGAGGCTGGAGGCTCCCCCCTCAACCCCTCTGCTCAGTGCCTGTGGGGAGCAGCCTCTACCCTCAGCATCCTGGCCACAAGTTCTTCCTTCCATTGTCCCTTTTCTTTATCCCTGACCTCTCTGAGAAGTGGGGTGTGGTCTCTCAGCTGTTCTGCCCTCATACCCTTAAAGGGCCAGCCTGGGCCCAGTGGACACAGGTAAGGCACCATGACCACCTGGTGTGACCTCTCTGTGCCT
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... IL9R(3581) , IL9R(3581)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
적합한 제품을 찾을 수 없으신가요?
당사의 제품 선택기 도구.을(를) 시도해 보세요.
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Blood, 129(24), 3196-3209 (2017-04-30)
Severe thrombocytopenia is a significant challenge in patients undergoing myelosuppressive chemotherapy for malignancies. Understanding the biology of platelet-producing megakaryocytes development in the bone marrow microenvironment may facilitate the development of novel therapies to stimulate platelet production and prevent thrombocytopenia. We
Oncology reports, 34(2), 795-802 (2015-06-18)
Interleukin-9 receptor (IL-9R) overexpression has a pivotal role in human hematological malignancies. However, the expression of IL-9R and its biological role in human solid tumors remains elusive. In the present study, western blot analysis and RT-qPCR were used to determine
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.