콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU077521

Sigma-Aldrich

MISSION® esiRNA

targeting human UBE2C

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

CCTCATGATGTCTGGCGATAAAGGGATTTCTGCCTTCCCTGAATCAGACAACCTTTTCAAATGGGTAGGGACCATCCATGGAGCAGCTGGAACAGTATATGAAGACCTGAGGTATAAGCTCTCGCTAGAGTTCCCCAGTGGCTACCCTTACAATGCGCCCACAGTGAAGTTCCTCACGCCCTGCTATCACCCCAACGTGGACACCCAGGGTAACATATGCCTGGACATCCTGAAGGAAAAGTGGTCTGCCCTGTATGATGTCAGGACCATTCTGCTCTCCATCCAGAGCCTTCTAGGAGAACCCAACATTGATAGTCCCTTGAACACACATGCTGCCGAGCTCTGGAAAAACCCCACAGCTTTTAAGAAGTACCTGCAAGAAACCTACTCAAAGCAGGTCACCAGC

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Pei-Feng Liu et al.
Diagnostics (Basel, Switzerland), 10(9) (2020-09-10)
Ubiquitin-conjugating enzyme 2C (UBE2C) involves in numerous cellular processes and the tumor progression in many cancers. However, its role in oral squamous cell carcinoma (OSCC) is unclear. We aimed to investigate the role and clinical significance of UBE2C in OSCC.
Xianxing Wang et al.
The FEBS journal, 286(24), 4889-4909 (2019-11-13)
Ubiquitin-conjugating enzyme 2C (UBE2C) is a core ubiquitin-conjugating enzyme in the ubiquitin-proteasome system that promotes cell cycle progression. Previous studies have indicated that UBE2C mediates tumorigenesis and progression in various cancers, but its role in pancreatic ductal adenocarcinoma (PDAC) remains
Liang Guo et al.
Cell cycle (Georgetown, Tex.), 16(18), 1705-1718 (2017-08-03)
Ubiquitin-conjugating enzyme E2C (UBE2C) is characterized as a crucial molecule in cancer cell growth that plays an essential role in the development of gliomas, but the detailed mechanisms have not been fully elucidated. In this study, we found that Forkhead
Ying Wang et al.
Biochemical and biophysical research communications, 534, 597-603 (2020-11-24)
Ubiquitin Conjugating Enzyme E2 C (UBE2C) has a key oncogenic role in many human malignancies, including gastric cancer. However, it remains largely unknow at which level UBE2C expression is altered, as well as what are the downstream targets of UBE2C.
Rui Wang et al.
International journal of oncology, 50(4), 1116-1126 (2017-03-06)
The ubiquitin-conjugating enzyme 2C (UBE2C) is the key component in the ubiquitin proteasome system (UPS) by partnering with the anaphase‑promoting complex (APC/C). A high UBE2C protein expression level has been reported in various types of human tumors. However, little is known about the precise mechanism

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.