설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
CCTCATGATGTCTGGCGATAAAGGGATTTCTGCCTTCCCTGAATCAGACAACCTTTTCAAATGGGTAGGGACCATCCATGGAGCAGCTGGAACAGTATATGAAGACCTGAGGTATAAGCTCTCGCTAGAGTTCCCCAGTGGCTACCCTTACAATGCGCCCACAGTGAAGTTCCTCACGCCCTGCTATCACCCCAACGTGGACACCCAGGGTAACATATGCCTGGACATCCTGAAGGAAAAGTGGTCTGCCCTGTATGATGTCAGGACCATTCTGCTCTCCATCCAGAGCCTTCTAGGAGAACCCAACATTGATAGTCCCTTGAACACACATGCTGCCGAGCTCTGGAAAAACCCCACAGCTTTTAAGAAGTACCTGCAAGAAACCTACTCAAAGCAGGTCACCAGC
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... UBE2C(11065) , UBE2C(11065)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Pei-Feng Liu et al.
Diagnostics (Basel, Switzerland), 10(9) (2020-09-10)
Ubiquitin-conjugating enzyme 2C (UBE2C) involves in numerous cellular processes and the tumor progression in many cancers. However, its role in oral squamous cell carcinoma (OSCC) is unclear. We aimed to investigate the role and clinical significance of UBE2C in OSCC.
Xianxing Wang et al.
The FEBS journal, 286(24), 4889-4909 (2019-11-13)
Ubiquitin-conjugating enzyme 2C (UBE2C) is a core ubiquitin-conjugating enzyme in the ubiquitin-proteasome system that promotes cell cycle progression. Previous studies have indicated that UBE2C mediates tumorigenesis and progression in various cancers, but its role in pancreatic ductal adenocarcinoma (PDAC) remains
Liang Guo et al.
Cell cycle (Georgetown, Tex.), 16(18), 1705-1718 (2017-08-03)
Ubiquitin-conjugating enzyme E2C (UBE2C) is characterized as a crucial molecule in cancer cell growth that plays an essential role in the development of gliomas, but the detailed mechanisms have not been fully elucidated. In this study, we found that Forkhead
UBE2C mRNA expression controlled by miR-300 and HuR determines its oncogenic role in gastric cancer.
Ying Wang et al.
Biochemical and biophysical research communications, 534, 597-603 (2020-11-24)
Ubiquitin Conjugating Enzyme E2 C (UBE2C) has a key oncogenic role in many human malignancies, including gastric cancer. However, it remains largely unknow at which level UBE2C expression is altered, as well as what are the downstream targets of UBE2C.
Rui Wang et al.
International journal of oncology, 50(4), 1116-1126 (2017-03-06)
The ubiquitin-conjugating enzyme 2C (UBE2C) is the key component in the ubiquitin proteasome system (UPS) by partnering with the anaphase‑promoting complex (APC/C). A high UBE2C protein expression level has been reported in various types of human tumors. However, little is known about the precise mechanism
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.