콘텐츠로 건너뛰기
Merck
모든 사진(1)

Key Documents

EHU076601

Sigma-Aldrich

MISSION® esiRNA

targeting human SMARCA4

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

GTGGACCTGAATGAGGAGGAAACCATTCTCATCATCCGGCGTCTCCACAAAGTGCTGCGGCCCTTCTTGCTCCGACGACTCAAGAAGGAAGTCGAGGCCCAGTTGCCCGAAAAGGTGGAGTACGTCATCAAGTGCGACATGTCTGCGCTGCAGCGAGTGCTCTACCGCCACATGCAGGCCAAGGGCGTGCTGCTGACTGATGGCTCCGAGAAGGACAAGAAGGGCAAAGGCGGCACCAAGACCCTGATGAACACCATCATGCAGCTGCGGAAGATCTGCAACCACCCCTACATGTTCCAGCACATCGAGGAGTCCTTTTCCGAGCACTTGGGGTTCACTGGCGGCATTGTCCAAGGGCTGGACCTGTACCGAGCCTCGGGTAAATTTGAGCTTCTTGATAGAATTCTTCCCAAACTCCGAGCAACCAACCACAAAGTGCTGCTGT

Ensembl | 인체 수납 번호

ENSG00000127616

NCBI 수납 번호

NM_003072

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... SMARCA4(6597) , SMARCA4(6597)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Wentao Sun et al.
European journal of pharmacology, 875, 173038-173038 (2020-02-28)
High glucose (HG)-induced oxidative damage of retinal ganglion cells (RGCs) contributes to the pathogenesis of diabetic retinopathy, a severe complication of diabetes mellitus. Brahma-related gene 1 (Brg1) has currently emerged as a cytoprotective protein that alleviates oxidative damage induced by
Shujie Song et al.
Molecular cancer research : MCR, 18(12), 1777-1788 (2020-08-29)
The NF-E2-related factor 2 (referred to as NRF2) transcription factor binds antioxidant responsive elements within the promoters of cytoprotective genes to induce their expression. Next-generation sequencing studies in lung cancer have shown a significant number of activating mutations within the
Xiaoping Liu et al.
Free radical biology & medicine, 160, 820-836 (2020-09-21)
Brahma-related gene 1 (BRG1) regulates the chromatin structure and expression of cardiac genes. Although BRG1 is downregulated in adult cardiomyocytes, it is reactivated during cardiac stress. The role of BRG1 in acute myocardial infarction (AMI) has not been clearly defined.
Tatiana Souslova et al.
Molecular neurobiology, 54(10), 8263-8277 (2016-12-04)
Five-prime repressor element under dual repression binding protein-1 (Freud-1)/CC2D1A is genetically linked to intellectual disability and implicated in neuronal development. Freud-1 represses the serotonin-1A (5-HT1A) receptor gene HTR1A by histone deacetylase (HDAC)-dependent or HDAC-independent mechanisms in 5-HT1A-negative (e.g., HEK-293) or
Yanru Li et al.
Journal of biochemical and molecular toxicology, 32(4), e22044-e22044 (2018-02-20)
Accumulating evidence has reported that microRNA-144-3p (miR-144-3p) is highly related to oxidative stress and apoptosis. However, little is known regarding its role in cerebral ischemia/reperfusion-induced neuronal injury. Herein, our results showed that miR-144-3p expression was significantly downregulated in neurons following
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.