설명
Powered by Eupheria Biotech
제품 라인
MISSION®
형태
lyophilized powder
esiRNA cDNA 표적 서열
GTGGTTCTGTTGTTGGAGCAAGTGTATTTTACAAGGATGTTGCTGGTTTGGATACAGAAGGCAGTAAACAGCGAAGTGCCTCTCAGAGTAGTTTAGATAAGTTAGATCAGGAACTTAAGGAACAGCAGAAGGAGTTAAAAAATCAAGAAGAATTATCCAGTCTAGTTTGGATCTGTACCAGCACTCATTCGGCTACAAAAGTTCTTATTATTGATGCTGTTCAACCTGGCAACATCCTAGACAGTTTCACTGTTTGCAACTCTCATGTTCTGTGCATTGCAAGTGTGCCAGGTGCACGAGAAACAGACTACCCTGCAGGAGAAGATCTTTCAGAATCTGGTCAGGTAGACAAAGCATCTTTATGTGGAAGTATGACAAGCAACAGCTCAGCAGAGACAGACAGCCTG
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... SPAG9(9043) , SPAG9(9043)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
시험 성적서(COA)
제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.
Qin Hui Sun et al.
BMC cancer, 20(1), 522-522 (2020-06-07)
microRNAs (miRNAs) play essential roles in the development and progression of gastric cancer (GC). Although aberrant miR-874 expression has been reported in various human cancers, its role in GC remains obscure. miR-874 expression was assessed by real-time quantitative polymerase chain
Hui Li et al.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 35(7), 6949-6954 (2014-04-18)
Sperm-associated antigen 9 (SPAG9) was recently reported to be overexpressed in several cancers and associated with the malignant behavior of cancer cells. However, the expression pattern of SPAG9 and its clinical significance in human prostate cancer have not been reported.
Feifei Chen et al.
Oncology reports, 32(6), 2533-2540 (2014-10-14)
Sperm-associated antigen 9 (SPAG9) is a recently characterized oncoprotein involved in the progression of several human malignancies. To elucidate the role of SPAG9 in the development of human prostate cancer (PCa), tissue microarray (TMA) and immunohistochemistry were used to detect
Zhi-Feng Miao et al.
Virchows Archiv : an international journal of pathology, 467(5), 525-533 (2015-08-22)
Sperm associated antigen 9 (SPAG9) protein has been found to play an important role in cancer progression but the involved mechanisms are still obscure. Its clinical significance in human gastric cancers remains unexplored. In the present study, SPAG9 expression was
Luis Bonet-Ponce et al.
Science advances, 6(46) (2020-11-13)
Genetic variation around the LRRK2 gene affects risk of both familial and sporadic Parkinson's disease (PD). However, the biological functions of LRRK2 remain incompletely understood. Here, we report that LRRK2 is recruited to lysosomes after exposure of cells to the
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.