콘텐츠로 건너뛰기
Merck
모든 사진(1)

Key Documents

EHU075501

Sigma-Aldrich

MISSION® esiRNA

targeting human CUX1

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

AAGCAAGGAAGCTGAAGCAGCTTTCTTGAATGTCTACAAAAGATTGATTGACGTCCCAGATCCCGTACCAGCTTTGGATCTCGGACAGCAACTCCAGCTCAAAGTGCAGCGCCTGCACGATATTGAAACAGAGAACCAGAAACTTAGGGAAACTCTGGAAGAATACAACAAGGAATTTGCTGAAGTGAAAAATCAAGAGGTTACGATAAAAGCACTTAAAGAGAAAATCCGAGAATATGAACAGACACTGAAGAACCAAGCCGAAACCATAGCTCTTGAGAAGGAACAGAAGTTACAGAATGACTTTGCAGAAAAGGAGAGAAAGCTGCAGGAGACACAGATGTCCACCACCTCAAAGCTGGAGGAAGCTGAGCATAAGGTTCAGAGCCTACAAACAGCCCTGGAAA

Ensembl | 인체 수납 번호

ENSG00000160967

NCBI 수납 번호

NM_001913

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... CUX1(1523) , CUX1(1523)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Liza J Burton et al.
PloS one, 14(4), e0214844-e0214844 (2019-04-10)
Triple-Negative Breast Cancers (TNBCs) are the most difficult to treat subtype of breast cancer and are often associated with high nuclear expression of Snail and Cathepsin L (Cat L) protease. We have previously shown that Snail can increase Cat L
Xiao Zhang et al.
Neurochemical research, 45(12), 2840-2855 (2020-10-02)
Circular RNAs (circRNAs) played pivotal roles in the initiation and progression of cancers. CircRNA cut like homeobox 1 (circ-CUX1; hsa_circ_0132813) has been reported to contribute to neuroblastoma (NB) development by previous study. Furthermore, previous works reported that microRNA-16-5p (miR-16-5p) was
Junfeng Wang et al.
Oncology reports, 37(5), 3068-3074 (2017-04-14)
The homeobox transcription factor CUTL1 has been associated with cellular proliferation and cell cycle progression, and CUTL1 functions as an oncogene. The aim of the present study was to investigate whether CUTL1 participates in epithelial-mesenchymal transition (EMT). The expression levels
Tian Gao et al.
Cancer biology & medicine, 17(2), 371-386 (2020-06-27)
Objective: Osteosarcoma is a common primary highly malignant bone tumor. Kinesin family member 18B (KIF18B) has been identified as a potential oncogene involved in the development and metastasis of several cancer types. While KIF18B overexpression in osteosarcoma tissue is clearly

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.