콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU075291

Sigma-Aldrich

MISSION® esiRNA

targeting human VPS35

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

CGTGAAGATGGACCTGGAATCCCAGCGGATATTAAACTTTTTGATATATTTTCACAGCAGGTGGCTACAGTGATACAGTCTAGACAAGACATGCCTTCAGAGGATGTTGTATCTTTACAAGTCTCTCTGATTAATCTTGCCATGAAATGTTACCCTGATCGTGTGGACTATGTTGATAAAGTTCTAGAAACAACAGTGGAGATATTCAATAAGCTCAACCTTGAACATATTGCTACCAGTAGTGCAGTTTCAAAGGAACTCACCAGACTTTTGAAAATACCAGTTGACACTTACAACAATATTTTAACAGTCTTGAAATTAAAACATTTTCACCCACTCTTTGAGTACTTTGACTACGAGTCCAGAAAGAGCATGAGTTGTTATGTGCTTAGTAATGTTCTGGATTATAACACAGAAATTGTCTCTCAAGACCAGGTGGATTCCAT

Ensembl | 인체 수납 번호

ENSG00000069329

NCBI 수납 번호

NM_018206

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... VPS35(55737) , VPS35(55737)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number
GWT
HUT
OOT
XJT
EGS

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

COA 검색

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Peiqi Yin et al.
Cellular and molecular life sciences : CMLS, 73(4), 869-881 (2015-08-25)
Hepatitis C virus (HCV) has infected over 170 million people worldwide. Phosphatidylinositol 4-phosphate (PI4P) is the organelle-specific phosphoinositide enriched at sites of HCV replication. Whether retromer, a PI4P-related host transport machinery, unloads its cargo at HCV replication sites remains inconclusive.
Anna Ansell-Schultz et al.
Molecular and cellular neurosciences, 93, 18-26 (2018-09-27)
Alzheimer's disease (AD) is a neurodegenerative disorder characterized by a progressive loss of multiple cognitive functions. Accumulation of amyloid beta oligomers (oAβ) play a major role in the neurotoxicity associated with the disease process. One of the early affected brain
Ming Sun et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 34(2), 2730-2748 (2020-01-08)
The small GTPase Ras-related protein Rab-7a (Rab7a) serves as a key organizer of the endosomal-lysosomal system. However, molecular mechanisms controlling Rab7a activation levels and subcellular translocation are still poorly defined. Here, we demonstrate that type Igamma phosphatidylinositol phosphate 5-kinase i5
Amod Godbole et al.
Nature communications, 8(1), 443-443 (2017-09-07)
A new paradigm of G-protein-coupled receptor (GPCR) signaling at intracellular sites has recently emerged, but the underlying mechanisms and functional consequences are insufficiently understood. Here, we show that upon internalization in thyroid cells, endogenous TSH receptors traffic retrogradely to the
Prasad Tammineni et al.
Human molecular genetics, 26(22), 4352-4366 (2017-10-04)
Lysosomal proteolysis is essential for the quality control of intracellular components and the maintenance of cellular homeostasis. Lysosomal alterations have been implicated as one of the main cellular defects contributing to the onset and progression of Alzheimer's disease (AD). However
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.