콘텐츠로 건너뛰기
Merck
모든 사진(1)

문서

EHU073481

Sigma-Aldrich

MISSION® esiRNA

targeting human EZH2

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

TCATGCAACACCCAACACTTATAAGCGGAAGAACACAGAAACAGCTCTAGACAACAAACCTTGTGGACCACAGTGTTACCAGCATTTGGAGGGAGCAAAGGAGTTTGCTGCTGCTCTCACCGCTGAGCGGATAAAGACCCCACCAAAACGTCCAGGAGGCCGCAGAAGAGGACGGCTTCCCAATAACAGTAGCAGGCCCAGCACCCCCACCATTAATGTGCTGGAATCAAAGGATACAGACAGTGATAGGGAAGCAGGGACTGAAACGGGGGGAGAGAACAATGATAAAGAAGAAGAAGAGAAGAAAGATGAAACTTCGAGCTCCTCTGAAGCAAATTCTCGGTGTCAAACACCAATAAAGATGAAGCCAAATATTGAACCTCCTGAGAATGTGGAGTGGAGTGGTGCT

Ensembl | 인체 수납 번호

ENSG00000106462

NCBI 수납 번호

NM_152998

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... EZH2(2146) , EZH2(2146)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Hailong Liu et al.
Molecular cancer research : MCR, 15(9), 1275-1286 (2017-05-26)
Medulloblastoma is the most common malignant brain tumor in children. Although accumulated research has suggested that cancer stem-like cells play a key role in medulloblastoma tumorigenesis, the specific molecular mechanism regarding proliferation remains elusive. Here, we reported more abundant expression
Jiewei Xu et al.
Pathology, research and practice, 215(6), 152374-152374 (2019-04-07)
EZH2 is a core component of the polycomb repressive complex 2 (PRC2), which catalyzes trimethylation of histone H3 lysine 27 (H3K27me3) and promotes carcinogenesis by epigenetically silencing many tumor suppressor genes. Increased EZH2 expression is a marker of advanced and
Junchao Xue et al.
Biochimica et biophysica acta, 1863(3), 753-763 (2017-01-08)
Circular RNAs (circRNAs), a class of noncoding RNAs generated from pre-mRNAs, participate in regulation of genes. The mechanism for regulation, however, is unknown. Here, to determine if, in human keratinocyte (HaCaT) cells, circular RNAs are involved in arsenite-induced acceleration of
Wei Dong et al.
American journal of physiology. Cell physiology, 317(2), C253-C261 (2019-01-17)
Myocardial ischemia-reperfusion (I/R) is a common and lethal disease that threatens people's life worldwide. The underlying mechanisms are under intensive study and yet remain unclear. Here, we explored the function of miR-322/503 in myocardial I/R injury. We used isolated rat
Ya-Nan Shu et al.
Cardiovascular research, 113(10), 1198-1207 (2017-04-19)
Sirtuin 1 (SIRT1) inhibits nuclear factor kappa B (NF-κB) activity in response to the inflammatory cytokine tumour necrosis factor alpha (TNF-α). Smooth muscle (SM) 22α is a phosphorylation-regulated suppressor of IKK-IκBα-NF-κB signalling cascades in vascular smooth muscle cells (VSMCs). Sm22α
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.