추천 제품
설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
GAGGACAAGTTGCATGAGCAGTGTCGACCCTGGAGGAAGAATGCCTGCTGTTCTACCAACACCAGCCAGGAAGCCCATAAGGATGTTTCCTACCTATATAGATTCAACTGGAACCACTGTGGAGAGATGGCACCTGCCTGCAAACGGCATTTCATCCAGGACACCTGCCTCTACGAGTGCTCCCCCAACTTGGGGCCCTGGATCCAGCAGGTGGATCAGAGCTGGCGCAAAGAGCGGGTACTGAACGTGCCCCTGTGCAAAGAGGACTGTGAGCAATGGTGGGAAGATTGTCGCACCTCCTACACCTGCAAGAGCAACTGGCACAAGGGCTGGAACTGGACTTCAGGGTTTAACAAGTGCGCAGTGGGAGCTGCCTGCCAACCTTTCCATTTCTACTTCCCCACACCCAC
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... FOLR1(2348) , FOLR1(2348)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Qiang Fu et al.
BioFactors (Oxford, England), 46(1), 136-145 (2019-10-18)
The present study was aimed to explore the functional role of microRNA (miR)-29b in colon cancer, as well as underlying mechanisms. Expressions of miR-29b and folate receptor 1 (FOLR1) were measured in both human colon tumor samples and cell lines.
Linda E Kelemen et al.
PloS one, 9(5), e96542-e96542 (2014-05-09)
Serum concentrations of the tumor-associated folate receptor 1 (FOLR1) protein may be a marker for early cancer detection, yet concentrations have also been detected in cancer-free women. We investigated the conditions associated with circulating FOLR1 protein in healthy individuals and
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.